Incidental Mutation 'R8553:Auts2'
ID659964
Institutional Source Beutler Lab
Gene Symbol Auts2
Ensembl Gene ENSMUSG00000029673
Gene Nameautism susceptibility candidate 2
SynonymsD830032G16Rik, 2700063G02Rik, A730011F23Rik
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R8553 (G1)
Quality Score225.009
Status Not validated
Chromosome5
Chromosomal Location131437333-132543344 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 131440143 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 779 (T779A)
Ref Sequence ENSEMBL: ENSMUSP00000139759 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000161374] [ENSMUST00000161804] [ENSMUST00000187544]
Predicted Effect probably benign
Transcript: ENSMUST00000161374
AA Change: T555A

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000124730
Gene: ENSMUSG00000029673
AA Change: T555A

DomainStartEndE-ValueType
low complexity region 3 15 N/A INTRINSIC
low complexity region 67 84 N/A INTRINSIC
low complexity region 92 105 N/A INTRINSIC
Pfam:Auts2 172 384 1.5e-112 PFAM
low complexity region 411 424 N/A INTRINSIC
low complexity region 533 543 N/A INTRINSIC
low complexity region 599 614 N/A INTRINSIC
low complexity region 741 757 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000161804
AA Change: T570A
SMART Domains Protein: ENSMUSP00000124027
Gene: ENSMUSG00000029673
AA Change: T570A

DomainStartEndE-ValueType
low complexity region 3 15 N/A INTRINSIC
low complexity region 67 84 N/A INTRINSIC
low complexity region 92 105 N/A INTRINSIC
Pfam:Auts2 187 399 3.9e-113 PFAM
low complexity region 426 439 N/A INTRINSIC
low complexity region 548 558 N/A INTRINSIC
low complexity region 614 629 N/A INTRINSIC
low complexity region 756 772 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000162101
Predicted Effect probably benign
Transcript: ENSMUST00000187544
AA Change: T779A

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000139759
Gene: ENSMUSG00000029673
AA Change: T779A

DomainStartEndE-ValueType
low complexity region 50 68 N/A INTRINSIC
low complexity region 83 125 N/A INTRINSIC
low complexity region 127 161 N/A INTRINSIC
low complexity region 168 183 N/A INTRINSIC
low complexity region 212 224 N/A INTRINSIC
low complexity region 276 293 N/A INTRINSIC
low complexity region 301 314 N/A INTRINSIC
Pfam:Auts2 396 608 4.3e-109 PFAM
low complexity region 635 648 N/A INTRINSIC
low complexity region 757 767 N/A INTRINSIC
low complexity region 823 838 N/A INTRINSIC
low complexity region 965 981 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene has been implicated in neurodevelopment and as a candidate gene for numerous neurological disorders, including autism spectrum disorders, intellectual disability, and developmental delay. Mutations in this gene have also been associated with non-neurological disorders, such as acute lymphoblastic leukemia, aging of the skin, early-onset androgenetic alopecia, and certain cancers. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, May 2014]
PHENOTYPE: Mice homozygous for a brain-specific knockout are smaller than controls, and exhibit behavioral defects such as less vocalizations, impairments in righting response and geotaxis, and decreased food intake. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700061G19Rik T A 17: 56,881,021 D176E probably benign Het
2210016F16Rik G A 13: 58,384,880 T92M probably damaging Het
4933427I04Rik A G 4: 123,860,534 I80M probably benign Het
Aga G A 8: 53,520,332 R255H probably damaging Het
Anapc1 G A 2: 128,619,913 P1757L possibly damaging Het
Arfgef3 T A 10: 18,603,530 I1446L probably damaging Het
Cacna1s T C 1: 136,091,802 S778P possibly damaging Het
Cep164 A T 9: 45,807,210 probably benign Het
Cmya5 T C 13: 93,093,796 T1595A probably benign Het
Csmd3 G T 15: 47,621,328 T3214K possibly damaging Het
Dpy30 A G 17: 74,315,918 L23P probably damaging Het
Edrf1 A G 7: 133,650,318 E391G possibly damaging Het
Egflam A T 15: 7,207,748 V985E probably damaging Het
Elmo3 T C 8: 105,307,178 V201A probably benign Het
Epb41l5 T A 1: 119,549,941 D700V possibly damaging Het
Esr1 T C 10: 4,997,847 S467P probably damaging Het
Eya4 G A 10: 23,106,258 H601Y probably damaging Het
Fam189b A C 3: 89,186,846 D322A possibly damaging Het
Fancm A C 12: 65,126,695 N1927T possibly damaging Het
Gcfc2 A G 6: 81,935,963 T248A probably benign Het
Gm29106 T A 1: 118,200,419 C614S probably damaging Het
Greb1 T C 12: 16,723,327 T249A probably benign Het
Hectd4 T C 5: 121,353,598 S3700P possibly damaging Het
Hr T C 14: 70,567,525 L950P probably damaging Het
Hsd3b3 T A 3: 98,743,889 T82S possibly damaging Het
Ifit2 C A 19: 34,573,138 A26E probably benign Het
Igsf9b A G 9: 27,333,443 D902G probably damaging Het
Itga4 G A 2: 79,301,061 R591Q probably damaging Het
Kcnb1 A T 2: 167,104,611 S772R possibly damaging Het
Klhl32 T A 4: 24,629,343 I213L probably benign Het
Lcn3 A T 2: 25,766,335 probably null Het
Lpin2 T A 17: 71,231,237 S293T probably damaging Het
Magi2 T C 5: 20,651,200 F840S probably benign Het
Myt1 G A 2: 181,797,551 E289K possibly damaging Het
Ndst4 A G 3: 125,710,107 S8G probably damaging Het
Nlrp4f T C 13: 65,195,438 D109G possibly damaging Het
Olfr214 G T 6: 116,557,328 R301L probably damaging Het
Pcdhb12 C T 18: 37,437,634 A611V probably damaging Het
Pcif1 A T 2: 164,886,497 I225F probably damaging Het
Peli3 A G 19: 4,934,932 F150L probably damaging Het
Rfx7 A G 9: 72,611,804 T263A probably damaging Het
Rpn1 A G 6: 88,095,557 Y294C probably damaging Het
Rusc2 T A 4: 43,416,508 S605T probably benign Het
Sec23ip A C 7: 128,754,053 Q300P probably damaging Het
Sh2d3c A G 2: 32,745,913 T98A probably damaging Het
Siah3 T A 14: 75,525,627 I106K probably benign Het
Spns2 C T 11: 72,457,227 D305N probably damaging Het
Sult1a1 G T 7: 126,674,161 Q177K probably benign Het
Tas2r109 A G 6: 132,980,208 I253T probably benign Het
Tcof1 T C 18: 60,831,571 D661G possibly damaging Het
Tdrd1 A G 19: 56,843,152 N325S probably damaging Het
Tfcp2l1 C A 1: 118,632,352 A58E probably damaging Het
Wdcp T C 12: 4,852,024 probably benign Het
Other mutations in Auts2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01739:Auts2 APN 5 131440218 missense probably benign 0.00
IGL01751:Auts2 APN 5 131472360 missense probably damaging 0.99
IGL02070:Auts2 APN 5 131470421 missense probably damaging 1.00
R0032:Auts2 UTSW 5 131440093 missense probably damaging 1.00
R0033:Auts2 UTSW 5 131440093 missense probably damaging 1.00
R0046:Auts2 UTSW 5 131770785 exon noncoding transcript
R0399:Auts2 UTSW 5 131440524 missense probably benign 0.37
R0412:Auts2 UTSW 5 131446831 missense probably benign 0.02
R0551:Auts2 UTSW 5 131440469 missense possibly damaging 0.75
R1536:Auts2 UTSW 5 131487463 intron probably benign
R1573:Auts2 UTSW 5 131440487 missense probably damaging 1.00
R1789:Auts2 UTSW 5 131472450 missense probably damaging 1.00
R1912:Auts2 UTSW 5 131443574 missense probably damaging 1.00
R2431:Auts2 UTSW 5 132259048 nonsense probably null
R3745:Auts2 UTSW 5 131476587 utr 5 prime probably benign
R4290:Auts2 UTSW 5 131474971 missense probably damaging 1.00
R4575:Auts2 UTSW 5 132258934 missense probably benign 0.17
R4576:Auts2 UTSW 5 132258934 missense probably benign 0.17
R4578:Auts2 UTSW 5 132258934 missense probably benign 0.17
R4623:Auts2 UTSW 5 131440383 missense probably benign 0.25
R4632:Auts2 UTSW 5 131472275 missense probably damaging 1.00
R4663:Auts2 UTSW 5 131439638 missense probably damaging 1.00
R4835:Auts2 UTSW 5 131466093 missense probably damaging 1.00
R4881:Auts2 UTSW 5 131472450 missense probably damaging 1.00
R5030:Auts2 UTSW 5 131443498 missense probably benign 0.00
R5032:Auts2 UTSW 5 131476891 utr 5 prime probably benign
R5078:Auts2 UTSW 5 132258947 missense possibly damaging 0.85
R5093:Auts2 UTSW 5 131439458 missense probably damaging 0.99
R5182:Auts2 UTSW 5 131475081 missense probably null 0.01
R5305:Auts2 UTSW 5 131443794 intron probably benign
R5429:Auts2 UTSW 5 131472335 missense probably damaging 1.00
R5601:Auts2 UTSW 5 131476823 utr 5 prime probably benign
R5725:Auts2 UTSW 5 131439746 missense probably benign 0.35
R5990:Auts2 UTSW 5 131476895 utr 5 prime probably benign
R6074:Auts2 UTSW 5 131476989 utr 5 prime probably benign
R6130:Auts2 UTSW 5 131440223 missense probably damaging 1.00
R6321:Auts2 UTSW 5 131466115 missense probably damaging 1.00
R6974:Auts2 UTSW 5 131440599 missense probably benign 0.01
R7000:Auts2 UTSW 5 131440218 missense probably benign 0.01
R7014:Auts2 UTSW 5 131466123 missense probably damaging 1.00
R7154:Auts2 UTSW 5 131451893 missense
R7812:Auts2 UTSW 5 131472446 missense
R7922:Auts2 UTSW 5 131440373 missense
R8159:Auts2 UTSW 5 131460125 critical splice donor site probably null
Z1088:Auts2 UTSW 5 131476554 splice site probably benign
Predicted Primers PCR Primer
(F):5'- TGTCCAAGTCACGGTAAGGATCC -3'
(R):5'- AGGCCTAACAGCACCTCTAGTC -3'

Sequencing Primer
(F):5'- GTCACGGTAAGGATCCCTCAAG -3'
(R):5'- TAACAGCACCTCTAGTCGGGAAG -3'
Posted On2021-01-18