Mutagenetix > Incidental Mutations

Incidental Mutation 'R5429:Auts2'

427064

Institutional Source

Beutler Lab

Gene Symbol

Auts2

Ensembl Gene

ENSMUSG00000029673

Gene Name

autism susceptibility candidate 2

Synonyms

D830032G16Rik, 2700063G02Rik, A730011F23Rik

MMRRC Submission

042995-MU

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R5429 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

131437333-132543344 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to A at 131472335 bp

Zygosity

Heterozygous

Amino Acid Change

Threonine to Methionine at position 289 (T289M)

Ref Sequence

ENSEMBL: ENSMUSP00000139759 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000161374] [ENSMUST00000161804] [ENSMUST00000187544]

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000159507

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000160071

SMART Domains

Protein: ENSMUSP00000125349
Gene: ENSMUSG00000029673

Domain	Start	End	E-Value	Type
low complexity region	3	15	N/A	INTRINSIC
low complexity region	67	84	N/A	INTRINSIC
low complexity region	92	105	N/A	INTRINSIC
Pfam:Auts2	194	406	2.3e-108	PFAM
low complexity region	433	446	N/A	INTRINSIC
low complexity region	555	565	N/A	INTRINSIC
low complexity region	621	636	N/A	INTRINSIC
low complexity region	763	779	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000161226

SMART Domains

Protein: ENSMUSP00000124900
Gene: ENSMUSG00000029673

Domain	Start	End	E-Value	Type
low complexity region	11	45	N/A	INTRINSIC
low complexity region	62	82	N/A	INTRINSIC
low complexity region	133	150	N/A	INTRINSIC
low complexity region	199	214	N/A	INTRINSIC
low complexity region	297	315	N/A	INTRINSIC
low complexity region	330	355	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000161374
AA Change: T80M

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000124730
Gene: ENSMUSG00000029673
AA Change: T80M

Domain	Start	End	E-Value	Type
low complexity region	3	15	N/A	INTRINSIC
low complexity region	67	84	N/A	INTRINSIC
low complexity region	92	105	N/A	INTRINSIC
Pfam:Auts2	172	384	1.5e-112	PFAM
low complexity region	411	424	N/A	INTRINSIC
low complexity region	533	543	N/A	INTRINSIC
low complexity region	599	614	N/A	INTRINSIC
low complexity region	741	757	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000161804
AA Change: T80M

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000124027
Gene: ENSMUSG00000029673
AA Change: T80M

Domain	Start	End	E-Value	Type
low complexity region	3	15	N/A	INTRINSIC
low complexity region	67	84	N/A	INTRINSIC
low complexity region	92	105	N/A	INTRINSIC
Pfam:Auts2	187	399	3.9e-113	PFAM
low complexity region	426	439	N/A	INTRINSIC
low complexity region	548	558	N/A	INTRINSIC
low complexity region	614	629	N/A	INTRINSIC
low complexity region	756	772	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000182575

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000182974

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000183153

Predicted Effect

probably damaging
Transcript: ENSMUST00000187544
AA Change: T289M

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000139759
Gene: ENSMUSG00000029673
AA Change: T289M

Domain	Start	End	E-Value	Type
low complexity region	50	68	N/A	INTRINSIC
low complexity region	83	125	N/A	INTRINSIC
low complexity region	127	161	N/A	INTRINSIC
low complexity region	168	183	N/A	INTRINSIC
low complexity region	212	224	N/A	INTRINSIC
low complexity region	276	293	N/A	INTRINSIC
low complexity region	301	314	N/A	INTRINSIC
Pfam:Auts2	396	608	4.3e-109	PFAM
low complexity region	635	648	N/A	INTRINSIC
low complexity region	757	767	N/A	INTRINSIC
low complexity region	823	838	N/A	INTRINSIC
low complexity region	965	981	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000198149

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.2%
20x: 95.0%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene has been implicated in neurodevelopment and as a candidate gene for numerous neurological disorders, including autism spectrum disorders, intellectual disability, and developmental delay. Mutations in this gene have also been associated with non-neurological disorders, such as acute lymphoblastic leukemia, aging of the skin, early-onset androgenetic alopecia, and certain cancers. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, May 2014]
PHENOTYPE: Mice homozygous for a brain-specific knockout are smaller than controls, and exhibit behavioral defects such as less vocalizations, impairments in righting response and geotaxis, and decreased food intake. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 47 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2410141K09Rik	G	A	13: 66,431,828	P199S	probably benign	Het
Akap13	T	G	7: 75,602,904	S261A	possibly damaging	Het
Ankrd34a	G	A	3: 96,597,521	G14R	probably damaging	Het
Btaf1	G	A	19: 36,994,857	V1331I	possibly damaging	Het
Ciz1	T	A	2: 32,376,043	I609K	possibly damaging	Het
Clca3b	C	T	3: 144,846,459	V154I	probably damaging	Het
Csde1	A	G	3: 103,052,841	T564A	possibly damaging	Het
Csrnp2	A	G	15: 100,482,054	V452A	probably benign	Het
Ctnnd1	C	T	2: 84,616,789	V371M	probably damaging	Het
Dock6	T	C	9: 21,832,881	D677G	probably damaging	Het
Filip1l	A	T	16: 57,570,255	E402V	probably damaging	Het
Gad1-ps	G	A	10: 99,445,147		noncoding transcript	Het
Ghr	G	A	15: 3,388,675	Q37*	probably null	Het
Gm10770	C	T	2: 150,179,423	R58H	probably benign	Het
Gm12789	T	C	4: 101,989,961	Y148H	possibly damaging	Het
Herc4	T	A	10: 63,275,013	N234K	probably benign	Het
Itih3	A	G	14: 30,923,521	V10A	probably benign	Het
Kat14	T	A	2: 144,393,323	D234E	probably benign	Het
Kif13a	A	G	13: 46,772,769		probably null	Het
Kif2b	A	G	11: 91,577,229	V76A	probably benign	Het
Mboat1	A	G	13: 30,219,667	T150A	probably benign	Het
Mfsd1	T	A	3: 67,599,960	L398H	probably damaging	Het
Myt1l	G	A	12: 29,832,332	G509R	unknown	Het
Nfx1	T	C	4: 41,004,343	C705R	probably damaging	Het
Olfr318	T	A	11: 58,720,524	N175Y	probably damaging	Het
Olfr60	A	G	7: 140,345,273	F239L	possibly damaging	Het
Pcdh10	T	C	3: 45,384,200	S931P	probably benign	Het
Pdpk1	T	C	17: 24,091,560	E205G	probably benign	Het
Ppp2r2a	A	T	14: 67,023,756	F172I	probably damaging	Het
Ppp2r5e	T	A	12: 75,453,763	D452V	probably damaging	Het
Rims2	A	T	15: 39,345,355	T185S	probably damaging	Het
Rpusd4	T	C	9: 35,272,602	V209A	probably benign	Het
Safb	T	C	17: 56,588,822	V20A	probably benign	Het
Scaf8	C	A	17: 3,197,110	P903T	probably benign	Het
Slc30a7	A	G	3: 116,006,925	S31P	possibly damaging	Het
Slc9b1	T	C	3: 135,373,263		probably null	Het
Sntb1	C	G	15: 55,642,795	G461R	probably damaging	Het
Tbc1d32	T	C	10: 56,027,993	D1226G	probably damaging	Het
Tlnrd1	G	T	7: 83,882,314	T303N	probably damaging	Het
Tmc1	G	T	19: 20,789,622	N738K	possibly damaging	Het
Tmem41a	A	G	16: 21,934,856	I255T	probably benign	Het
Trim7	G	A	11: 48,849,955	C293Y	probably damaging	Het
Trpc6	C	T	9: 8,634,074	Q385*	probably null	Het
Ttc39b	A	G	4: 83,243,953	I330T	possibly damaging	Het
Vil1	C	T	1: 74,432,331	T757I	probably benign	Het
Zfp462	T	C	4: 55,060,077	V1201A	probably damaging	Het
Zfp473	T	A	7: 44,732,848	E686V	possibly damaging	Het

Other mutations in Auts2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01739:Auts2	APN	5	131440218	missense	probably benign	0.00
IGL01751:Auts2	APN	5	131472360	missense	probably damaging	0.99
IGL02070:Auts2	APN	5	131470421	missense	probably damaging	1.00
R0032:Auts2	UTSW	5	131440093	missense	probably damaging	1.00
R0033:Auts2	UTSW	5	131440093	missense	probably damaging	1.00
R0046:Auts2	UTSW	5	131770785	exon	noncoding transcript
R0399:Auts2	UTSW	5	131440524	missense	probably benign	0.37
R0412:Auts2	UTSW	5	131446831	missense	probably benign	0.02
R0551:Auts2	UTSW	5	131440469	missense	possibly damaging	0.75
R1536:Auts2	UTSW	5	131487463	intron	probably benign
R1573:Auts2	UTSW	5	131440487	missense	probably damaging	1.00
R1789:Auts2	UTSW	5	131472450	missense	probably damaging	1.00
R1912:Auts2	UTSW	5	131443574	missense	probably damaging	1.00
R2431:Auts2	UTSW	5	132259048	nonsense	probably null
R3745:Auts2	UTSW	5	131476587	utr 5 prime	probably benign
R4290:Auts2	UTSW	5	131474971	missense	probably damaging	1.00
R4575:Auts2	UTSW	5	132258934	missense	probably benign	0.17
R4576:Auts2	UTSW	5	132258934	missense	probably benign	0.17
R4578:Auts2	UTSW	5	132258934	missense	probably benign	0.17
R4623:Auts2	UTSW	5	131440383	missense	probably benign	0.25
R4632:Auts2	UTSW	5	131472275	missense	probably damaging	1.00
R4663:Auts2	UTSW	5	131439638	missense	probably damaging	1.00
R4835:Auts2	UTSW	5	131466093	missense	probably damaging	1.00
R4881:Auts2	UTSW	5	131472450	missense	probably damaging	1.00
R5030:Auts2	UTSW	5	131443498	missense	probably benign	0.00
R5032:Auts2	UTSW	5	131476891	utr 5 prime	probably benign
R5078:Auts2	UTSW	5	132258947	missense	possibly damaging	0.85
R5093:Auts2	UTSW	5	131439458	missense	probably damaging	0.99
R5182:Auts2	UTSW	5	131475081	missense	probably null	0.01
R5305:Auts2	UTSW	5	131443794	intron	probably benign
R5601:Auts2	UTSW	5	131476823	utr 5 prime	probably benign
R5725:Auts2	UTSW	5	131439746	missense	probably benign	0.35
R5990:Auts2	UTSW	5	131476895	utr 5 prime	probably benign
R6074:Auts2	UTSW	5	131476989	utr 5 prime	probably benign
R6130:Auts2	UTSW	5	131440223	missense	probably damaging	1.00
R6321:Auts2	UTSW	5	131466115	missense	probably damaging	1.00
R6974:Auts2	UTSW	5	131440599	missense	probably benign	0.01
R7000:Auts2	UTSW	5	131440218	missense	probably benign	0.01
R7014:Auts2	UTSW	5	131466123	missense	probably damaging	1.00
R7154:Auts2	UTSW	5	131451893	missense
R7812:Auts2	UTSW	5	131472446	missense
R7922:Auts2	UTSW	5	131440373	missense
R8159:Auts2	UTSW	5	131460125	critical splice donor site	probably null
R8553:Auts2	UTSW	5	131440143	missense	probably benign	0.00
Z1088:Auts2	UTSW	5	131476554	splice site	probably benign

Predicted Primers

PCR Primer
(F):5'- TTAGCAAAGATGGACAGGACCTAC -3'
(R):5'- AAGGCGTCACCACCGTTAAC -3'

Sequencing Primer
(F):5'- AGCATTCACAGAGTGGCC -3'
(R):5'- GTCACCACCGTTAACTCCCTTTG -3'

Posted On

2016-09-01