Incidental Mutation 'R8743:Adam5'
ID663352
Institutional Source Beutler Lab
Gene Symbol Adam5
Ensembl Gene ENSMUSG00000031554
Gene Namea disintegrin and metallopeptidase domain 5
SynonymstMDCII
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.053) question?
Stock #R8743 (G1)
Quality Score225.009
Status Not validated
Chromosome8
Chromosomal Location24727093-24824369 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 24786248 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Serine at position 468 (C468S)
Ref Sequence ENSEMBL: ENSMUSP00000052661 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000050300] [ENSMUST00000118419] [ENSMUST00000209935]
Predicted Effect probably damaging
Transcript: ENSMUST00000050300
AA Change: C468S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000052661
Gene: ENSMUSG00000031554
AA Change: C468S

DomainStartEndE-ValueType
low complexity region 3 14 N/A INTRINSIC
Pfam:Pep_M12B_propep 16 142 1.6e-19 PFAM
Pfam:Reprolysin 185 378 7.7e-59 PFAM
DISIN 397 474 9.1e-42 SMART
ACR 475 618 6.9e-58 SMART
transmembrane domain 695 712 N/A INTRINSIC
low complexity region 718 751 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000118419
AA Change: C468S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000112422
Gene: ENSMUSG00000031554
AA Change: C468S

DomainStartEndE-ValueType
low complexity region 3 14 N/A INTRINSIC
Pfam:Pep_M12B_propep 16 142 4.7e-30 PFAM
Pfam:Reprolysin 185 378 7.9e-56 PFAM
DISIN 397 474 1.78e-39 SMART
ACR 475 618 2.06e-55 SMART
transmembrane domain 695 712 N/A INTRINSIC
low complexity region 718 750 N/A INTRINSIC
Predicted Effect
SMART Domains Protein: ENSMUSP00000121272
Gene: ENSMUSG00000031554
AA Change: C385S

DomainStartEndE-ValueType
Pfam:Pep_M12B_propep 1 60 6.7e-14 PFAM
Pfam:Reprolysin 103 296 2.5e-61 PFAM
DISIN 315 392 1.78e-39 SMART
ACR 393 536 2.06e-55 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000209935
AA Change: C468S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.2%
  • 20x: 96.7%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a member of a disintegrin and metalloprotease (ADAM) family of endoproteases that play important roles in various biological processes including cell signaling, adhesion and migration. The encoded preproprotein undergoes proteolytic processing to generate a mature, functional protein. This gene is located in a cluster of related ADAM genes on chromosome 8. Alternative splicing results in multiple transcript variants encoding different isoforms, some of which may undergo similar processing. [provided by RefSeq, May 2016]
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700022I11Rik A G 4: 42,971,030 H121R probably benign Het
4930430A15Rik T C 2: 111,169,672 T198A unknown Het
Adamts7 G A 9: 90,195,243 R1321H probably damaging Het
Adra2c T C 5: 35,280,448 V188A possibly damaging Het
Ampd2 C A 3: 108,080,116 V134L probably benign Het
Ap1g1 A G 8: 109,837,791 N323D probably damaging Het
Arhgap15 A T 2: 43,748,864 probably benign Het
Arhgef33 T C 17: 80,360,453 probably null Het
Armc1 C T 3: 19,157,536 C40Y probably benign Het
Arsk C A 13: 76,066,809 V309F probably damaging Het
Atp4b A T 8: 13,393,489 M63K probably damaging Het
Cacna1s T C 1: 136,105,548 L1237P probably damaging Het
Ccnt2 A G 1: 127,774,283 E19G probably damaging Het
Ccr2 A C 9: 124,106,094 Y137S probably damaging Het
Cdc40 C T 10: 40,841,484 D404N probably damaging Het
Cfh A T 1: 140,118,585 probably null Het
Chd5 T A 4: 152,366,405 V662E probably benign Het
Cnga4 A G 7: 105,408,013 D544G probably benign Het
Col6a3 C G 1: 90,767,606 probably null Het
Coro6 T A 11: 77,466,439 I158N probably damaging Het
Cpa1 A G 6: 30,642,993 S307G probably damaging Het
Depdc5 T A 5: 32,924,243 M583K probably benign Het
Dock2 G T 11: 34,273,252 S1170* probably null Het
Dusp16 A T 6: 134,717,970 S633T probably benign Het
Esco1 T C 18: 10,572,123 E739G probably damaging Het
Fam193a T A 5: 34,420,157 probably null Het
Fam71e2 T A 7: 4,757,815 T633S Het
Fat4 G A 3: 38,888,443 S495N probably benign Het
Galnt10 A G 11: 57,784,583 Y556C probably damaging Het
Gc A T 5: 89,443,452 D142E probably benign Het
Gda A T 19: 21,400,588 F369Y probably damaging Het
Glce A T 9: 62,060,821 S349R probably benign Het
Glp2r A G 11: 67,722,075 L351P probably damaging Het
Gtf2h5 C CA 17: 6,084,558 probably null Het
Gxylt2 A T 6: 100,787,323 Y323F probably benign Het
Hmmr T C 11: 40,708,031 N589D probably damaging Het
Hsd17b3 A C 13: 64,062,898 D214E probably benign Het
Kat6a A G 8: 22,939,006 D1459G possibly damaging Het
Lad1 G A 1: 135,831,195 R465H probably benign Het
Lcmt1 T A 7: 123,400,468 D46E probably damaging Het
Map4k1 G A 7: 28,987,117 D155N probably damaging Het
Mylk G T 16: 34,921,057 R796L probably benign Het
Nat8l T A 5: 33,997,166 L108Q probably damaging Het
Nlrp5 T C 7: 23,418,747 V632A probably benign Het
Nr3c2 A G 8: 76,909,758 E496G probably damaging Het
Nucb2 A G 7: 116,528,830 D258G probably damaging Het
Olfr874 G T 9: 37,746,878 C248F probably benign Het
Olfr923 A T 9: 38,827,699 I3F probably benign Het
Papln A G 12: 83,782,990 K962E probably damaging Het
Pcdha8 T A 18: 36,994,319 M618K probably benign Het
Pclo A G 5: 14,714,566 D1066G Het
Phip A T 9: 82,927,087 M446K probably benign Het
Pkn3 A G 2: 30,083,306 K380R probably benign Het
Ppa1 C A 10: 61,660,979 A82E possibly damaging Het
Prune2 A C 19: 17,119,556 D808A probably benign Het
Psme4 T G 11: 30,878,467 L1829R probably damaging Het
Rtp4 A C 16: 23,613,116 K133Q possibly damaging Het
Scaf11 C T 15: 96,415,788 A1371T probably benign Het
Serpinb9g A T 13: 33,494,948 H267L probably benign Het
Slc47a2 T G 11: 61,342,762 D6A probably benign Het
Slco1a4 A T 6: 141,819,529 V329D possibly damaging Het
Smg6 T C 11: 74,930,033 S377P probably benign Het
Sprr2b CTGAGCCTTGTCCTCCTCCAAAGTGCCCTGAGCCTTGTCCTCCCCCAGTATGCTGTGAGCCTTGTCCTCCTCCAAAGTGCCCTGAGCCTTGTCCTCCCCCAGTATGCTGTGAGCCTTGTCCTCC CTGAGCCTTGTCCTCCTCCAAAGTGCCCTGAGCCTTGTCCTCCCCCAGTATGCTGTGAGCCTTGTCCTCC 3: 92,317,519 probably benign Het
Taar2 A T 10: 23,941,471 Y303F probably damaging Het
Tgm6 A G 2: 130,143,498 D407G probably damaging Het
Twf2 A G 9: 106,212,811 E153G possibly damaging Het
Upb1 A G 10: 75,439,876 Y365C probably damaging Het
Vmn2r4 A T 3: 64,409,826 S164T possibly damaging Het
Wtip C T 7: 34,125,554 G202R possibly damaging Het
Zfhx4 G A 3: 5,244,024 C770Y probably damaging Het
Other mutations in Adam5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00823:Adam5 APN 8 24818742 missense probably benign 0.18
IGL01285:Adam5 APN 8 24781594 missense probably benign 0.02
IGL01310:Adam5 APN 8 24742134 intron probably benign
IGL01510:Adam5 APN 8 24804465 missense probably damaging 1.00
IGL01570:Adam5 APN 8 24810823 missense probably damaging 1.00
IGL02017:Adam5 APN 8 24781759 missense probably benign 0.38
IGL02191:Adam5 APN 8 24812423 nonsense probably null
IGL02397:Adam5 APN 8 24744133 intron probably benign
IGL02488:Adam5 APN 8 24792006 missense probably damaging 0.98
IGL02490:Adam5 APN 8 24781704 nonsense probably null
IGL02499:Adam5 APN 8 24781565 critical splice donor site probably null
IGL02539:Adam5 APN 8 24786213 nonsense probably null
IGL02590:Adam5 APN 8 24744135 intron probably benign
IGL02677:Adam5 APN 8 24812379 splice site probably benign
IGL02679:Adam5 APN 8 24806526 missense probably damaging 1.00
IGL02982:Adam5 APN 8 24804431 missense probably benign 0.02
IGL03146:Adam5 APN 8 24804503 missense probably damaging 0.98
IGL03162:Adam5 APN 8 24781604 missense probably benign 0.30
IGL03284:Adam5 APN 8 24786338 splice site probably benign
R0081:Adam5 UTSW 8 24781687 missense probably damaging 1.00
R0377:Adam5 UTSW 8 24747541 missense probably benign 0.08
R0398:Adam5 UTSW 8 24813432 missense probably benign 0.17
R0771:Adam5 UTSW 8 24786299 missense probably benign 0.04
R0925:Adam5 UTSW 8 24812425 missense probably benign 0.09
R1547:Adam5 UTSW 8 24810713 missense probably benign 0.10
R1985:Adam5 UTSW 8 24746739 missense probably benign 0.01
R2115:Adam5 UTSW 8 24744145 intron probably benign
R2125:Adam5 UTSW 8 24815118 missense probably damaging 1.00
R2144:Adam5 UTSW 8 24815480 missense probably benign 0.14
R3151:Adam5 UTSW 8 24781631 missense probably damaging 0.99
R3612:Adam5 UTSW 8 24818089 splice site probably benign
R3844:Adam5 UTSW 8 24813410 missense probably benign 0.12
R3873:Adam5 UTSW 8 24815109 missense probably benign 0.02
R4514:Adam5 UTSW 8 24818136 missense probably damaging 1.00
R4843:Adam5 UTSW 8 24813536 missense probably damaging 1.00
R4866:Adam5 UTSW 8 24742156 splice site probably null
R4866:Adam5 UTSW 8 24781603 missense probably damaging 0.98
R4900:Adam5 UTSW 8 24742156 splice site probably null
R4900:Adam5 UTSW 8 24781603 missense probably damaging 0.98
R4903:Adam5 UTSW 8 24786232 missense probably damaging 1.00
R4936:Adam5 UTSW 8 24786271 missense probably damaging 1.00
R4964:Adam5 UTSW 8 24786232 missense probably damaging 1.00
R5259:Adam5 UTSW 8 24810834 missense possibly damaging 0.90
R5293:Adam5 UTSW 8 24810706 missense possibly damaging 0.46
R5724:Adam5 UTSW 8 24804495 nonsense probably null
R5859:Adam5 UTSW 8 24813461 missense probably benign
R6004:Adam5 UTSW 8 24781669 missense probably benign 0.04
R6175:Adam5 UTSW 8 24786151 missense probably benign 0.00
R6539:Adam5 UTSW 8 24782600 missense possibly damaging 0.85
R6994:Adam5 UTSW 8 24786246 nonsense probably null
R6996:Adam5 UTSW 8 24806501 missense probably damaging 1.00
R7009:Adam5 UTSW 8 24806438 missense probably benign 0.00
R7115:Adam5 UTSW 8 24781696 missense possibly damaging 0.69
R7127:Adam5 UTSW 8 24810781 missense probably damaging 1.00
R7469:Adam5 UTSW 8 24815525 missense probably benign 0.45
R7780:Adam5 UTSW 8 24804416 missense possibly damaging 0.49
R8027:Adam5 UTSW 8 24782558 missense probably damaging 1.00
R8069:Adam5 UTSW 8 24813525 missense probably damaging 1.00
R8138:Adam5 UTSW 8 24781762 missense probably damaging 1.00
R8305:Adam5 UTSW 8 24810703 missense possibly damaging 0.93
R8359:Adam5 UTSW 8 24806486 missense probably damaging 1.00
R8480:Adam5 UTSW 8 24804459 nonsense probably null
X0019:Adam5 UTSW 8 24812443 missense probably benign 0.00
X0022:Adam5 UTSW 8 24813563 critical splice acceptor site probably null
X0027:Adam5 UTSW 8 24818772 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGTCCTGAAGAATTGAATAATGGGC -3'
(R):5'- TGATTCATCCTAAGGGAGGCC -3'

Sequencing Primer
(F):5'- CTGAAGAATTGAATAATGGGCATTGG -3'
(R):5'- AATGGGGCCACCTCATGAG -3'
Posted On2021-03-08