Incidental Mutation 'R4514:Adam5'
ID332801
Institutional Source Beutler Lab
Gene Symbol Adam5
Ensembl Gene ENSMUSG00000031554
Gene Namea disintegrin and metallopeptidase domain 5
SynonymstMDCII
MMRRC Submission 041588-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.054) question?
Stock #R4514 (G1)
Quality Score225
Status Not validated
Chromosome8
Chromosomal Location24727093-24824369 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 24818136 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Proline at position 51 (T51P)
Ref Sequence ENSEMBL: ENSMUSP00000147290 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000050300] [ENSMUST00000118419] [ENSMUST00000209935]
Predicted Effect probably damaging
Transcript: ENSMUST00000050300
AA Change: T51P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000052661
Gene: ENSMUSG00000031554
AA Change: T51P

DomainStartEndE-ValueType
low complexity region 3 14 N/A INTRINSIC
Pfam:Pep_M12B_propep 16 142 1.6e-19 PFAM
Pfam:Reprolysin 185 378 7.7e-59 PFAM
DISIN 397 474 9.1e-42 SMART
ACR 475 618 6.9e-58 SMART
transmembrane domain 695 712 N/A INTRINSIC
low complexity region 718 751 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000118419
AA Change: T51P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000112422
Gene: ENSMUSG00000031554
AA Change: T51P

DomainStartEndE-ValueType
low complexity region 3 14 N/A INTRINSIC
Pfam:Pep_M12B_propep 16 142 4.7e-30 PFAM
Pfam:Reprolysin 185 378 7.9e-56 PFAM
DISIN 397 474 1.78e-39 SMART
ACR 475 618 2.06e-55 SMART
transmembrane domain 695 712 N/A INTRINSIC
low complexity region 718 750 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130939
Predicted Effect probably benign
Transcript: ENSMUST00000132180
SMART Domains Protein: ENSMUSP00000121272
Gene: ENSMUSG00000031554

DomainStartEndE-ValueType
Pfam:Pep_M12B_propep 1 60 6.7e-14 PFAM
Pfam:Reprolysin 103 296 2.5e-61 PFAM
DISIN 315 392 1.78e-39 SMART
ACR 393 536 2.06e-55 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000209935
AA Change: T51P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.6%
  • 10x: 96.9%
  • 20x: 94.1%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a member of a disintegrin and metalloprotease (ADAM) family of endoproteases that play important roles in various biological processes including cell signaling, adhesion and migration. The encoded preproprotein undergoes proteolytic processing to generate a mature, functional protein. This gene is located in a cluster of related ADAM genes on chromosome 8. Alternative splicing results in multiple transcript variants encoding different isoforms, some of which may undergo similar processing. [provided by RefSeq, May 2016]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Akr1c20 A C 13: 4,507,844 V201G probably damaging Het
Alg9 C T 9: 50,805,354 T409M possibly damaging Het
Arpp21 T A 9: 112,177,677 T155S probably damaging Het
Atm T A 9: 53,493,039 Q1334L probably damaging Het
Bptf G A 11: 107,077,692 T1055M probably damaging Het
Cd3g C A 9: 44,973,584 A121S possibly damaging Het
Cenpn A G 8: 116,933,396 Y68C probably damaging Het
Clock A G 5: 76,230,199 I618T probably benign Het
Cp A G 3: 19,988,013 M982V probably damaging Het
Csf3r T A 4: 126,039,860 S611T possibly damaging Het
Csn3 A G 5: 87,930,138 T168A unknown Het
Cylc2 C G 4: 51,229,651 T331R unknown Het
D630003M21Rik T C 2: 158,204,802 T752A probably benign Het
Defb34 A T 8: 19,126,506 D71V probably damaging Het
Dync1h1 T A 12: 110,657,139 D3615E possibly damaging Het
Etl4 A T 2: 20,661,898 T167S probably damaging Het
F5 T A 1: 164,151,997 probably benign Het
Got1l1 C T 8: 27,198,485 M279I probably benign Het
Grm7 A G 6: 111,358,304 T559A possibly damaging Het
Ifit1 A T 19: 34,648,513 R350* probably null Het
Ighv2-5 T C 12: 113,685,596 N79S possibly damaging Het
Igkv17-127 A G 6: 67,861,514 I70V possibly damaging Het
Itga8 T C 2: 12,182,736 S711G probably benign Het
Kndc1 A G 7: 139,910,286 T235A probably benign Het
Lct T C 1: 128,300,514 I1081V probably benign Het
Lrrc8b G T 5: 105,479,953 C55F probably damaging Het
Lrwd1 T C 5: 136,131,548 T311A probably benign Het
Mapk14 T C 17: 28,724,824 F129S probably damaging Het
Mdga2 A G 12: 66,716,722 I200T probably damaging Het
Mocos T A 18: 24,683,212 S615R probably damaging Het
Myh4 T C 11: 67,255,569 V1456A probably benign Het
Myh9 T C 15: 77,764,000 I1759V probably benign Het
Nat8f5 G A 6: 85,817,423 T185I possibly damaging Het
Nav3 T C 10: 109,694,082 I2133V possibly damaging Het
Ncam2 T A 16: 81,512,996 M458K probably benign Het
Nphp1 T C 2: 127,748,087 S532G probably benign Het
Olfr1184 T C 2: 88,487,365 V211A probably benign Het
Olfr649 C T 7: 104,189,391 R272H probably benign Het
Oplah A G 15: 76,297,955 L1035P probably damaging Het
Pask T A 1: 93,322,133 Q515L probably benign Het
Poglut1 A T 16: 38,549,416 F35I probably benign Het
Ppp1ca T G 19: 4,195,055 I319S probably benign Het
Psg25 T A 7: 18,529,608 R97* probably null Het
Sars2 T C 7: 28,742,284 probably null Het
Slc15a4 A G 5: 127,604,536 probably null Het
Slc16a7 T G 10: 125,233,439 probably null Het
Slc7a8 C G 14: 54,735,790 G240A possibly damaging Het
St6gal2 A T 17: 55,483,017 N351Y probably benign Het
Susd5 T C 9: 114,095,924 F292L probably benign Het
Tmco5 T A 2: 116,880,314 D38E probably damaging Het
Tubgcp2 G A 7: 139,996,071 P893L possibly damaging Het
Uncx A G 5: 139,546,767 I196V possibly damaging Het
Zeb1 G A 18: 5,759,007 C138Y probably damaging Het
Zfp609 A G 9: 65,703,695 I662T possibly damaging Het
Zfp985 G A 4: 147,583,563 C296Y probably damaging Het
Other mutations in Adam5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00823:Adam5 APN 8 24818742 missense probably benign 0.18
IGL01285:Adam5 APN 8 24781594 missense probably benign 0.02
IGL01310:Adam5 APN 8 24742134 intron probably benign
IGL01510:Adam5 APN 8 24804465 missense probably damaging 1.00
IGL01570:Adam5 APN 8 24810823 missense probably damaging 1.00
IGL02017:Adam5 APN 8 24781759 missense probably benign 0.38
IGL02191:Adam5 APN 8 24812423 nonsense probably null
IGL02397:Adam5 APN 8 24744133 intron probably benign
IGL02488:Adam5 APN 8 24792006 missense probably damaging 0.98
IGL02490:Adam5 APN 8 24781704 nonsense probably null
IGL02499:Adam5 APN 8 24781565 critical splice donor site probably null
IGL02539:Adam5 APN 8 24786213 nonsense probably null
IGL02590:Adam5 APN 8 24744135 intron probably benign
IGL02677:Adam5 APN 8 24812379 splice site probably benign
IGL02679:Adam5 APN 8 24806526 missense probably damaging 1.00
IGL02982:Adam5 APN 8 24804431 missense probably benign 0.02
IGL03146:Adam5 APN 8 24804503 missense probably damaging 0.98
IGL03162:Adam5 APN 8 24781604 missense probably benign 0.30
IGL03284:Adam5 APN 8 24786338 splice site probably benign
R0081:Adam5 UTSW 8 24781687 missense probably damaging 1.00
R0377:Adam5 UTSW 8 24747541 missense probably benign 0.08
R0398:Adam5 UTSW 8 24813432 missense probably benign 0.17
R0771:Adam5 UTSW 8 24786299 missense probably benign 0.04
R0925:Adam5 UTSW 8 24812425 missense probably benign 0.09
R1547:Adam5 UTSW 8 24810713 missense probably benign 0.10
R1985:Adam5 UTSW 8 24746739 missense probably benign 0.01
R2115:Adam5 UTSW 8 24744145 intron probably benign
R2125:Adam5 UTSW 8 24815118 missense probably damaging 1.00
R2144:Adam5 UTSW 8 24815480 missense probably benign 0.14
R3151:Adam5 UTSW 8 24781631 missense probably damaging 0.99
R3612:Adam5 UTSW 8 24818089 splice site probably benign
R3844:Adam5 UTSW 8 24813410 missense probably benign 0.12
R3873:Adam5 UTSW 8 24815109 missense probably benign 0.02
R4843:Adam5 UTSW 8 24813536 missense probably damaging 1.00
R4866:Adam5 UTSW 8 24742156 splice site probably null
R4866:Adam5 UTSW 8 24781603 missense probably damaging 0.98
R4900:Adam5 UTSW 8 24742156 splice site probably null
R4900:Adam5 UTSW 8 24781603 missense probably damaging 0.98
R4903:Adam5 UTSW 8 24786232 missense probably damaging 1.00
R4936:Adam5 UTSW 8 24786271 missense probably damaging 1.00
R4964:Adam5 UTSW 8 24786232 missense probably damaging 1.00
R5259:Adam5 UTSW 8 24810834 missense possibly damaging 0.90
R5293:Adam5 UTSW 8 24810706 missense possibly damaging 0.46
R5724:Adam5 UTSW 8 24804495 nonsense probably null
R5859:Adam5 UTSW 8 24813461 missense probably benign
R6004:Adam5 UTSW 8 24781669 missense probably benign 0.04
R6175:Adam5 UTSW 8 24786151 missense probably benign 0.00
R6539:Adam5 UTSW 8 24782600 missense possibly damaging 0.85
R6994:Adam5 UTSW 8 24786246 nonsense probably null
R6996:Adam5 UTSW 8 24806501 missense probably damaging 1.00
R7009:Adam5 UTSW 8 24806438 missense probably benign 0.00
R7115:Adam5 UTSW 8 24781696 missense possibly damaging 0.69
R7127:Adam5 UTSW 8 24810781 missense probably damaging 1.00
R7469:Adam5 UTSW 8 24815525 missense probably benign 0.45
R7780:Adam5 UTSW 8 24804416 missense possibly damaging 0.49
R8027:Adam5 UTSW 8 24782558 missense not run
R8069:Adam5 UTSW 8 24813525 missense not run
X0019:Adam5 UTSW 8 24812443 missense probably benign 0.00
X0022:Adam5 UTSW 8 24813563 critical splice acceptor site probably null
X0027:Adam5 UTSW 8 24818772 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGGTACATTGGAATATGTCTTCCTG -3'
(R):5'- AAGACTCAGGAATCCACGTGG -3'

Sequencing Primer
(F):5'- ATCATCTTTTATCAAGGACTAGGACC -3'
(R):5'- CCAAAAACCCATGTGTGTGTGTG -3'
Posted On2015-08-18