Incidental Mutation 'R8697:Ppm1d'
ID 668793
Institutional Source Beutler Lab
Gene Symbol Ppm1d
Ensembl Gene ENSMUSG00000020525
Gene Name protein phosphatase 1D magnesium-dependent, delta isoform
Synonyms Wip1
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R8697 (G1)
Quality Score 225.009
Status Validated
Chromosome 11
Chromosomal Location 85311244-85347066 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 85337160 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Histidine at position 301 (Y301H)
Ref Sequence ENSEMBL: ENSMUSP00000020835 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020835] [ENSMUST00000127717]
AlphaFold Q9QZ67
Predicted Effect possibly damaging
Transcript: ENSMUST00000020835
AA Change: Y301H

PolyPhen 2 Score 0.954 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000020835
Gene: ENSMUSG00000020525
AA Change: Y301H

DomainStartEndE-ValueType
PP2Cc 1 366 1.4e-76 SMART
PP2C_SIG 78 368 6.09e0 SMART
low complexity region 403 415 N/A INTRINSIC
Blast:PP2Cc 416 476 1e-19 BLAST
Predicted Effect
SMART Domains Protein: ENSMUSP00000115606
Gene: ENSMUSG00000020525
AA Change: Y156H

DomainStartEndE-ValueType
PP2Cc 1 170 2.87e-5 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.4%
Validation Efficiency 98% (58/59)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the PP2C family of Ser/Thr protein phosphatases. PP2C family members are known to be negative regulators of cell stress response pathways. The expression of this gene is induced in a p53-dependent manner in response to various environmental stresses. While being induced by tumor suppressor protein TP53/p53, this phosphatase negatively regulates the activity of p38 MAP kinase, MAPK/p38, through which it reduces the phosphorylation of p53, and in turn suppresses p53-mediated transcription and apoptosis. This phosphatase thus mediates a feedback regulation of p38-p53 signaling that contributes to growth inhibition and the suppression of stress induced apoptosis. This gene is located in a chromosomal region known to be amplified in breast cancer. The amplification of this gene has been detected in both breast cancer cell line and primary breast tumors, which suggests a role of this gene in cancer development. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null male mice show some embryonic lethality. Surviving males have variable abnormalities including runting, reproductive organ atrophy with associated reduced fertility, and reduced life span. Both genders have increased susceptibility to viral infection and reduced lymphocyte function. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930558K02Rik C T 1: 161,967,996 A8T probably benign Het
Acacb T C 5: 114,213,380 V1130A probably damaging Het
Ackr1 A G 1: 173,332,208 F248S probably damaging Het
Alx4 G A 2: 93,675,312 R253Q probably damaging Het
Ap3b2 T C 7: 81,473,035 I485V possibly damaging Het
Aqp7 T C 4: 41,045,305 E25G probably damaging Het
Cacna1g T C 11: 94,416,698 N1753D probably benign Het
Cacna2d1 T A 5: 16,365,867 N1063K possibly damaging Het
Cad T C 5: 31,074,601 V1801A probably benign Het
Ccdc171 T C 4: 83,682,340 W868R probably damaging Het
Cecr2 T C 6: 120,733,818 Y165H probably damaging Het
Clip4 G T 17: 71,856,275 G614V possibly damaging Het
Ctnnal1 T A 4: 56,838,986 M236L probably damaging Het
Ctps T C 4: 120,542,750 D470G probably benign Het
Dmwd A C 7: 19,078,188 Q189P probably damaging Het
Dnah17 A G 11: 118,086,159 I1869T possibly damaging Het
Eepd1 A G 9: 25,586,702 N361S probably benign Het
Ephb6 C T 6: 41,614,223 H105Y probably damaging Het
Fkbp15 A T 4: 62,321,058 Y603* probably null Het
Flt3 T C 5: 147,358,001 Y420C possibly damaging Het
Frem2 T A 3: 53,525,828 T2692S probably damaging Het
Gna12 T A 5: 140,785,445 R157S probably benign Het
Gsdmc A T 15: 63,780,034 S243T probably benign Het
Hectd1 A G 12: 51,772,537 probably benign Het
Hoxd11 G A 2: 74,682,669 G93R unknown Het
Hydin A G 8: 110,532,883 I2496V probably benign Het
Igsf10 A G 3: 59,318,887 I2455T probably benign Het
Ilvbl A T 10: 78,583,362 R482* probably null Het
Itpr1 A G 6: 108,523,366 Y2640C probably damaging Het
Kif20a C G 18: 34,628,531 Q326E probably benign Het
Lamp1 A T 8: 13,174,448 M371L possibly damaging Het
Lcn6 A G 2: 25,677,154 N56D probably benign Het
Map3k10 A G 7: 27,663,359 V434A probably benign Het
Mdga1 T C 17: 29,846,641 N331S probably damaging Het
Mndal C A 1: 173,872,992 E138* probably null Het
Morc3 T C 16: 93,871,020 V762A probably benign Het
Ngef A T 1: 87,489,737 F279Y probably damaging Het
Olfr1026 A T 2: 85,923,856 K196I possibly damaging Het
Olfr455 A G 6: 42,538,695 V109A probably damaging Het
Padi4 GGAGCTCCTGA GGA 4: 140,757,919 probably null Het
Pcdhb4 G A 18: 37,308,779 V381M probably benign Het
Rasgrf1 A G 9: 89,995,002 T807A probably benign Het
Repin1 G T 6: 48,597,345 E403* probably null Het
Sipa1l2 T C 8: 125,482,116 K518E probably damaging Het
Slc52a3 A G 2: 152,004,476 D119G probably damaging Het
Srsf4 C T 4: 131,900,731 H379Y unknown Het
Ssr1 G T 13: 37,983,449 S246* probably null Het
Tars2 C T 3: 95,746,062 E509K possibly damaging Het
Tcrg-C2 A T 13: 19,307,344 M69K Het
Tepsin G T 11: 120,097,528 Y34* probably null Het
Tmtc2 A G 10: 105,369,970 I488T probably damaging Het
Ttc37 A G 13: 76,180,155 S1441G probably damaging Het
Ttn A G 2: 76,744,776 W25258R probably damaging Het
Utp14b T C 1: 78,666,527 M714T probably benign Het
Vwa3b T A 1: 37,076,380 H308Q probably benign Het
Washc2 A G 6: 116,229,259 D480G probably benign Het
Xcl1 C T 1: 164,935,439 V18I unknown Het
Zcchc2 C A 1: 106,030,764 N988K probably damaging Het
Other mutations in Ppm1d
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02095:Ppm1d APN 11 85327006 missense probably benign 0.04
IGL02351:Ppm1d APN 11 85345715 missense probably damaging 0.99
IGL02358:Ppm1d APN 11 85345715 missense probably damaging 0.99
IGL02496:Ppm1d APN 11 85339666 missense possibly damaging 0.51
IGL02667:Ppm1d APN 11 85332285 missense probably damaging 1.00
IGL02885:Ppm1d APN 11 85326944 missense possibly damaging 0.52
IGL03085:Ppm1d APN 11 85337163 missense probably null 0.80
R0114:Ppm1d UTSW 11 85326905 missense probably damaging 1.00
R0606:Ppm1d UTSW 11 85345877 missense probably benign 0.27
R1014:Ppm1d UTSW 11 85337154 missense probably damaging 0.98
R1548:Ppm1d UTSW 11 85339605 missense probably damaging 1.00
R3774:Ppm1d UTSW 11 85337167 missense probably damaging 1.00
R3775:Ppm1d UTSW 11 85337167 missense probably damaging 1.00
R4025:Ppm1d UTSW 11 85345757 missense probably benign 0.09
R4065:Ppm1d UTSW 11 85345852 missense probably benign 0.01
R4067:Ppm1d UTSW 11 85345852 missense probably benign 0.01
R4118:Ppm1d UTSW 11 85311582 missense probably benign 0.01
R5169:Ppm1d UTSW 11 85332370 missense probably damaging 1.00
R5384:Ppm1d UTSW 11 85311783 missense probably damaging 0.98
R5861:Ppm1d UTSW 11 85311848 missense possibly damaging 0.70
R5890:Ppm1d UTSW 11 85326908 missense probably damaging 1.00
R6394:Ppm1d UTSW 11 85339672 missense probably benign
R6992:Ppm1d UTSW 11 85332352 missense probably damaging 1.00
R7006:Ppm1d UTSW 11 85337151 missense possibly damaging 0.92
R7297:Ppm1d UTSW 11 85345995 missense probably damaging 1.00
R7993:Ppm1d UTSW 11 85326951 missense probably damaging 1.00
R8099:Ppm1d UTSW 11 85339666 missense possibly damaging 0.51
R8738:Ppm1d UTSW 11 85345906 missense probably damaging 0.99
R9018:Ppm1d UTSW 11 85337135 missense probably damaging 0.98
R9188:Ppm1d UTSW 11 85345921 missense possibly damaging 0.93
Z1176:Ppm1d UTSW 11 85339573 missense probably benign 0.09
Z1177:Ppm1d UTSW 11 85326963 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCGAGGGAATTCTCTTGTCCC -3'
(R):5'- ACCTCCTTAGCTAGACTCACAG -3'

Sequencing Primer
(F):5'- GTTGTTGTGCACCTATAGGAACAGAC -3'
(R):5'- TTAGCTAGACTCACAGCCATGG -3'
Posted On 2021-04-30