Incidental Mutation 'R8705:Qrich2'
ID669243
Institutional Source Beutler Lab
Gene Symbol Qrich2
Ensembl Gene ENSMUSG00000070331
Gene Nameglutamine rich 2
SynonymsLOC217341
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.070) question?
Stock #R8705 (G1)
Quality Score112.592
Status Not validated
Chromosome11
Chromosomal Location116441325-116466241 bp(-) (GRCm38)
Type of Mutationsmall deletion (10 aa in frame mutation)
DNA Base Change (assembly) GCTGCACCTGGTTGCAACACACCAGGCTGAACTGCACCTGGTTGCAACACACCAGGCTGAACTGCACCTGGTTGCAACACACCAGGCTGAACTGCACCTGGTTG to GCTGCACCTGGTTGCAACACACCAGGCTGAACTGCACCTGGTTGCAACACACCAGGCTGAACTGCACCTGGTTG at 116457541 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000147009 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000093909] [ENSMUST00000208602]
Predicted Effect probably benign
Transcript: ENSMUST00000093909
SMART Domains Protein: ENSMUSP00000091437
Gene: ENSMUSG00000070331

DomainStartEndE-ValueType
low complexity region 25 37 N/A INTRINSIC
Pfam:DUF4795 97 304 3.7e-71 PFAM
low complexity region 471 491 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000208602
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.5%
Validation Efficiency 97% (36/37)
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Akr1c6 G T 13: 4,434,448 G20W probably damaging Het
Ces1c A G 8: 93,130,890 L21P probably benign Het
Col11a2 G T 17: 34,049,795 G394V unknown Het
Cyp2c70 A G 19: 40,180,504 V113A probably benign Het
Foxp1 C G 6: 99,016,546 Q132H unknown Het
Fras1 A T 5: 96,691,401 D1593V probably benign Het
Frzb G A 2: 80,446,897 probably benign Het
Gas6 T C 8: 13,475,156 D276G probably damaging Het
Gdf7 C T 12: 8,298,167 E377K probably damaging Het
Ggnbp2 A G 11: 84,862,306 F36L possibly damaging Het
Gm40460 A T 7: 142,240,997 C28S unknown Het
Hnrnpd A G 5: 99,963,729 probably benign Het
Hsd17b11 G A 5: 103,992,837 L265F probably benign Het
Hyal6 G A 6: 24,734,674 R202H probably benign Het
Igkv5-43 A G 6: 69,823,608 S32P probably benign Het
Kank1 A G 19: 25,411,543 Y860C probably damaging Het
Krt79 G A 15: 101,938,006 T169M probably damaging Het
Lama5 C T 2: 180,178,561 C3296Y probably damaging Het
Ly75 A T 2: 60,318,385 I1200K probably damaging Het
Myo1b A T 1: 51,863,336 Y78* probably null Het
Napb A G 2: 148,700,476 V188A probably benign Het
Neb T C 2: 52,258,783 Y2584C probably damaging Het
Olfr671 T C 7: 104,975,239 I253V possibly damaging Het
P4htm G A 9: 108,580,041 A381V probably damaging Het
Pcdha8 T A 18: 36,993,853 F463I probably damaging Het
Peg10 CCACATCAGGATCCACATCAGGATGCACATCAGCATCAGGATCCCCATCAGGATGCACATCAGGATCCACATCAGGATGCACATCAG CCACATCAGGATCCACATCAGGATGCACATCAG 6: 4,756,398 probably benign Het
Phip T C 9: 82,893,559 T1030A probably damaging Het
Phrf1 T A 7: 141,258,738 F615L unknown Het
Prrc2a A G 17: 35,153,566 S1700P possibly damaging Het
Rab9 C T X: 166,457,758 D186N probably benign Het
Sf3b5 G T 10: 13,008,810 R63L probably damaging Het
Sh3rf1 T C 8: 61,349,557 L308P probably damaging Het
Slc7a2 A T 8: 40,914,995 T599S probably damaging Het
Sox5 T C 6: 144,041,286 N184S possibly damaging Het
Traf3 A G 12: 111,242,504 E119G possibly damaging Het
Trim24 T C 6: 37,903,653 probably benign Het
Ubxn11 A T 4: 134,126,240 I368F probably damaging Het
Vmn2r27 C T 6: 124,230,229 G151D probably damaging Het
Wfdc16 T A 2: 164,638,475 R33S possibly damaging Het
Zfp654 A G 16: 64,785,070 V382A possibly damaging Het
Other mutations in Qrich2
AlleleSourceChrCoordTypePredicted EffectPPH Score
FR4449:Qrich2 UTSW 11 116456199 small deletion probably benign
R0122:Qrich2 UTSW 11 116446813 missense possibly damaging 0.61
R0157:Qrich2 UTSW 11 116441395 missense probably damaging 1.00
R1479:Qrich2 UTSW 11 116441485 missense probably benign 0.08
R1786:Qrich2 UTSW 11 116441449 missense probably damaging 1.00
R2115:Qrich2 UTSW 11 116447156 missense probably damaging 0.99
R2130:Qrich2 UTSW 11 116448417 splice site probably benign
R2178:Qrich2 UTSW 11 116443777 missense probably damaging 1.00
R3875:Qrich2 UTSW 11 116445651 missense probably damaging 0.98
R4378:Qrich2 UTSW 11 116446915 missense probably damaging 1.00
R5124:Qrich2 UTSW 11 116446773 missense probably damaging 1.00
R5362:Qrich2 UTSW 11 116447150 missense probably damaging 1.00
R5468:Qrich2 UTSW 11 116448365 missense probably damaging 1.00
R5493:Qrich2 UTSW 11 116445948 critical splice donor site probably null
R5589:Qrich2 UTSW 11 116441408 missense probably damaging 1.00
R5696:Qrich2 UTSW 11 116445002 missense probably damaging 1.00
R6046:Qrich2 UTSW 11 116447006 intron probably benign
R6183:Qrich2 UTSW 11 116458129 unclassified probably benign
R6193:Qrich2 UTSW 11 116454153 missense probably benign 0.07
R6211:Qrich2 UTSW 11 116453542 missense probably benign 0.41
R6375:Qrich2 UTSW 11 116458228 unclassified probably benign
R6452:Qrich2 UTSW 11 116455888 missense probably benign 0.01
R6870:Qrich2 UTSW 11 116455330 missense probably damaging 0.96
R7073:Qrich2 UTSW 11 116446875 missense probably damaging 0.98
R7552:Qrich2 UTSW 11 116456254 missense possibly damaging 0.63
R7585:Qrich2 UTSW 11 116455721 missense probably benign 0.00
R7586:Qrich2 UTSW 11 116455624 missense probably benign 0.43
R7588:Qrich2 UTSW 11 116465937 missense possibly damaging 0.53
R7633:Qrich2 UTSW 11 116456629 missense unknown
R7638:Qrich2 UTSW 11 116455322 missense probably benign 0.00
R7736:Qrich2 UTSW 11 116457541 small deletion probably benign
R7737:Qrich2 UTSW 11 116457541 small deletion probably benign
R7753:Qrich2 UTSW 11 116457042 small deletion probably benign
R7800:Qrich2 UTSW 11 116456860 nonsense probably null
R7833:Qrich2 UTSW 11 116455765 missense probably benign 0.04
R7912:Qrich2 UTSW 11 116455782 small deletion probably benign
R7923:Qrich2 UTSW 11 116457337 missense probably damaging 1.00
R8197:Qrich2 UTSW 11 116457035 small deletion probably benign
R8225:Qrich2 UTSW 11 116454068 missense probably damaging 1.00
R8300:Qrich2 UTSW 11 116456349 missense probably benign 0.04
R8391:Qrich2 UTSW 11 116465577 missense probably benign 0.00
R8792:Qrich2 UTSW 11 116456630 missense unknown
R8912:Qrich2 UTSW 11 116457541 small deletion probably benign
R8937:Qrich2 UTSW 11 116457245 small deletion probably benign
Z1176:Qrich2 UTSW 11 116456378 missense probably benign 0.00
Z1177:Qrich2 UTSW 11 116456668 missense unknown
Predicted Primers PCR Primer
(F):5'- ATGCCAGGCTGAACTGAACC -3'
(R):5'- TAGATCAGCTTGATATGGCACAAC -3'

Sequencing Primer
(F):5'- TGAGCTGCACCTGCTTG -3'
(R):5'- ACCACATGGAATTCTGCCTGG -3'
Posted On2021-04-30