Incidental Mutation 'R0733:Nlrp4d'
ID67104
Institutional Source Beutler Lab
Gene Symbol Nlrp4d
Ensembl Gene ENSMUSG00000034122
Gene NameNLR family, pyrin domain containing 4D
SynonymsNalp4d, Nalp-beta
MMRRC Submission 038914-MU
Accession Numbers

Genbank: XM_001481310; Ensembl: ENSMUST00000184509

 

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0733 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location10358862-10388935 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 10382522 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Valine at position 144 (E144V)
Gene Model predicted gene model for transcript(s):
Predicted Effect probably benign
Transcript: ENSMUST00000086269
AA Change: E144V

PolyPhen 2 Score 0.023 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000083450
Gene: ENSMUSG00000034122
AA Change: E144V

DomainStartEndE-ValueType
PYRIN 6 89 2.6e-31 SMART
Pfam:NACHT 150 318 2.4e-34 PFAM
low complexity region 575 586 N/A INTRINSIC
LRR 674 701 1.3e-1 SMART
Blast:LRR 703 729 8e-7 BLAST
LRR 730 756 2.1e-2 SMART
LRR 758 785 2.1e-1 SMART
LRR 786 813 1.6e-5 SMART
LRR 814 837 3.5e-1 SMART
LRR 838 865 2.7e-6 SMART
LRR 867 894 7.2e-2 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000182420
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.9%
  • 10x: 97.7%
  • 20x: 95.9%
Validation Efficiency 98% (60/61)
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931408C20Rik T A 1: 26,682,932 T1056S possibly damaging Het
Abl1 A G 2: 31,778,945 Y88C probably damaging Het
Acbd3 A G 1: 180,752,218 I476V possibly damaging Het
Apba2 T C 7: 64,750,164 I689T probably damaging Het
AU018091 A G 7: 3,159,161 Y362H probably damaging Het
Cdh26 T C 2: 178,486,931 S759P probably damaging Het
Clcc1 A G 3: 108,674,740 Q387R probably benign Het
Cobl C T 11: 12,365,167 G259R probably benign Het
Col4a1 C T 8: 11,218,934 R968Q possibly damaging Het
Ddr2 A G 1: 170,004,812 probably benign Het
Dera C A 6: 137,796,848 N201K probably damaging Het
Dsg1a A C 18: 20,338,668 E659A probably damaging Het
Dus2 G T 8: 106,046,070 probably null Het
Ears2 T A 7: 122,048,129 I311F possibly damaging Het
Eml4 T A 17: 83,454,464 M417K possibly damaging Het
Exosc4 A T 15: 76,329,416 M147L probably benign Het
Fam171a2 T A 11: 102,439,722 Y278F possibly damaging Het
Fastk A C 5: 24,443,923 H155Q probably null Het
Fem1b G T 9: 62,796,843 N378K possibly damaging Het
Fut11 C A 14: 20,695,359 Y119* probably null Het
Gatsl2 T C 5: 134,136,215 F208L possibly damaging Het
Gm6797 T C X: 8,645,149 noncoding transcript Het
Gstt4 T C 10: 75,817,314 D138G probably benign Het
Hprt G A X: 53,002,150 C66Y probably damaging Het
Inpp5d T A 1: 87,668,077 probably benign Het
Ints6l T A X: 56,501,748 S621T probably benign Het
Ints6l C G X: 56,504,812 A699G probably benign Het
Kctd3 A G 1: 188,997,050 probably benign Het
Kntc1 G T 5: 123,790,916 V1252L probably null Het
Lama5 A T 2: 180,180,718 M2854K possibly damaging Het
Lcn5 G T 2: 25,661,101 L187F probably damaging Het
Lrp3 A T 7: 35,202,120 L758M possibly damaging Het
Ltn1 T A 16: 87,412,507 I740F probably benign Het
Mcm5 A G 8: 75,127,248 K710R probably benign Het
Mllt10 A G 2: 18,203,766 probably benign Het
Nbr1 T A 11: 101,576,371 M864K probably benign Het
Nkiras2 T C 11: 100,624,932 probably null Het
Nppc T C 1: 86,669,634 probably benign Het
Ormdl2 T A 10: 128,819,999 Q94L probably damaging Het
Paox G C 7: 140,127,527 D88H probably damaging Het
Papd4 T A 13: 93,155,039 Q365L probably benign Het
Prl7a2 T C 13: 27,662,688 E114G probably damaging Het
Prpsap2 A G 11: 61,741,000 I177T possibly damaging Het
Prss54 T C 8: 95,559,740 D235G possibly damaging Het
Rwdd3 T C 3: 121,171,607 M24V probably benign Het
Serpinb6e T A 13: 33,841,218 N30I probably benign Het
Sh3rf1 G A 8: 61,372,560 A530T probably benign Het
Slc28a1 T C 7: 81,124,900 I165T probably benign Het
Slco6d1 T A 1: 98,428,269 L143* probably null Het
Snrnp40 C G 4: 130,378,043 probably null Het
Snx27 A G 3: 94,562,013 L7P probably benign Het
Spsb1 C T 4: 149,906,917 V65I probably benign Het
St8sia2 C T 7: 73,960,840 G232S probably benign Het
Sun1 A G 5: 139,231,163 H255R possibly damaging Het
Ube2k A G 5: 65,581,452 I95V probably damaging Het
Ube2m C A 7: 13,035,752 E126D probably damaging Het
Vmn2r27 A T 6: 124,192,188 M661K probably benign Het
Wdr47 A T 3: 108,618,623 D154V probably damaging Het
Zfp113 A G 5: 138,145,583 V135A probably benign Het
Other mutations in Nlrp4d
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00981:Nlrp4d APN 7 10382094 exon noncoding transcript
IGL01076:Nlrp4d APN 7 10372083 missense unknown 0.00
IGL01656:Nlrp4d APN 7 10364147 missense noncoding transcript
IGL01889:Nlrp4d APN 7 10378334 missense unknown 0.00
IGL02110:Nlrp4d APN 7 10382564 exon noncoding transcript
IGL02271:Nlrp4d APN 7 10388698 exon noncoding transcript
IGL02637:Nlrp4d APN 7 10382555 exon noncoding transcript
snoop UTSW 7 10374891 missense probably benign 0.02
1mM(1):Nlrp4d UTSW 7 10381713 missense probably benign 0.09
F5493:Nlrp4d UTSW 7 10381084 missense possibly damaging 0.84
IGL03048:Nlrp4d UTSW 7 10358954 unclassified noncoding transcript
R0116:Nlrp4d UTSW 7 10374891 missense probably benign 0.02
R0125:Nlrp4d UTSW 7 10382389 missense probably damaging 1.00
R0390:Nlrp4d UTSW 7 10388778 missense probably benign 0.04
R0452:Nlrp4d UTSW 7 10378292 missense probably benign 0.01
R0595:Nlrp4d UTSW 7 10381045 missense probably benign 0.00
R0729:Nlrp4d UTSW 7 10377685 critical splice donor site probably benign
R1147:Nlrp4d UTSW 7 10388717 missense probably benign 0.00
R1217:Nlrp4d UTSW 7 10364267 missense probably benign 0.36
R1378:Nlrp4d UTSW 7 10364184 missense probably benign 0.23
R1414:Nlrp4d UTSW 7 10382601 missense probably benign 0.22
R1583:Nlrp4d UTSW 7 10382237 missense probably damaging 0.99
R1585:Nlrp4d UTSW 7 10382510 missense probably benign 0.02
R1882:Nlrp4d UTSW 7 10382677 critical splice acceptor site noncoding transcript
R2422:Nlrp4d UTSW 7 10362945 missense probably benign 0.29
R2907:Nlrp4d UTSW 7 10378427 missense probably benign 0.00
R2964:Nlrp4d UTSW 7 10378329 nonsense probably null
R2974:Nlrp4d UTSW 7 10378440 critical splice acceptor site probably benign
R3401:Nlrp4d UTSW 7 10362854 missense probably damaging 1.00
R3402:Nlrp4d UTSW 7 10362854 missense probably damaging 1.00
R4240:Nlrp4d UTSW 7 10381316 missense noncoding transcript
R4682:Nlrp4d UTSW 7 10374952 missense noncoding transcript
R4766:Nlrp4d UTSW 7 10362779 critical splice donor site unknown
R4864:Nlrp4d UTSW 7 10381161 missense noncoding transcript
R4910:Nlrp4d UTSW 7 10378409 exon noncoding transcript
R5307:Nlrp4d UTSW 7 10362782 nonsense probably null
R5596:Nlrp4d UTSW 7 10382024 missense noncoding transcript
R5857:Nlrp4d UTSW 7 10382377 missense noncoding transcript
Predicted Primers PCR Primer
(F):5'- CAGTGTCTTGCCAATTCCAGCAAC -3'
(R):5'- CACAGAGAAATGCAACTGTGCTGC -3'

Sequencing Primer
(F):5'- TTCCAGCAACACCATACAGG -3'
(R):5'- ctctacaggaatccattaacacac -3'
Posted On2013-09-03