Incidental Mutation 'R8757:Ror1'
ID671676
Institutional Source Beutler Lab
Gene Symbol Ror1
Ensembl Gene ENSMUSG00000035305
Gene Namereceptor tyrosine kinase-like orphan receptor 1
Synonyms2810404D04Rik, Ntrkr1
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R8757 (G1)
Quality Score225.009
Status Not validated
Chromosome4
Chromosomal Location100095791-100444765 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 100440883 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Leucine at position 484 (F484L)
Ref Sequence ENSEMBL: ENSMUSP00000048171 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000039630]
Predicted Effect probably benign
Transcript: ENSMUST00000039630
AA Change: F484L

PolyPhen 2 Score 0.014 (Sensitivity: 0.96; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000048171
Gene: ENSMUSG00000035305
AA Change: F484L

DomainStartEndE-ValueType
signal peptide 1 29 N/A INTRINSIC
IGc2 70 138 8.37e-15 SMART
Pfam:Fz 170 290 4.9e-13 PFAM
KR 311 393 7.57e-47 SMART
transmembrane domain 404 426 N/A INTRINSIC
TyrKc 473 746 2.46e-137 SMART
low complexity region 753 762 N/A INTRINSIC
low complexity region 817 828 N/A INTRINSIC
low complexity region 849 864 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.4%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a receptor tyrosine kinase that has been implicated in nervous system development, specifically in the maintenance of neural progenitor cell fate, neurite extension and synapse formation. The encoded protein, likely a pseudokinase that lacks catalytic activity, may also regulate adipogenesis. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Aug 2015]
PHENOTYPE: Mice homozygous for some disruptions in this gene die within the first day after birth from respiratory defects. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
6030468B19Rik T C 11: 117,806,286 V237A probably benign Het
Abca15 G A 7: 120,407,408 V1632M probably damaging Het
Adam20 A T 8: 40,795,906 H351L probably benign Het
Ak9 T C 10: 41,423,040 V1579A unknown Het
Apol7e T C 15: 77,717,865 V221A probably benign Het
Arid5b T C 10: 68,097,810 H754R probably damaging Het
Atp6v0d2 T A 4: 19,910,649 R80S probably benign Het
Cers3 G A 7: 66,786,102 V270M probably damaging Het
Ces3a A G 8: 105,057,497 H443R probably damaging Het
Cnot7 A G 8: 40,494,039 V269A probably benign Het
Cntn1 T G 15: 92,255,920 F485V possibly damaging Het
Copa A G 1: 172,119,514 I1068M probably benign Het
Dchs2 G A 3: 83,354,260 V2612M possibly damaging Het
Dgkz T C 2: 91,945,577 T114A probably benign Het
Dock2 A T 11: 34,695,240 D538E probably benign Het
Epn3 C A 11: 94,496,022 G174V possibly damaging Het
Evx2 C T 2: 74,655,882 A388T probably benign Het
Fancd2 T C 6: 113,560,093 M553T possibly damaging Het
Ficd G T 5: 113,738,514 R250L probably damaging Het
Fmo2 A G 1: 162,880,436 S377P probably benign Het
Gm19410 A T 8: 35,808,965 Q1592L possibly damaging Het
Gm4792 T A 10: 94,295,187 T87S unknown Het
Gm7534 T C 4: 134,202,971 T8A unknown Het
Gm7879 A T 5: 43,913,657 N119I probably benign Het
Gm8947 C A 1: 151,193,058 T214K probably benign Het
H6pd C T 4: 149,982,301 V551I probably benign Het
Hace1 T A 10: 45,670,443 I391N possibly damaging Het
Heyl C T 4: 123,233,873 R3W probably damaging Het
Htr4 T A 18: 62,412,264 V40E probably damaging Het
Ighg1 A T 12: 113,329,037 L304* probably null Het
Igkv1-135 T A 6: 67,610,486 W114R possibly damaging Het
Itga8 T C 2: 12,262,129 D165G probably damaging Het
Kmt2a A T 9: 44,842,913 V1210E unknown Het
Lipt2 GGCGCCCGCGCGCG GGCG 7: 100,159,681 probably null Het
Lrrc37a A G 11: 103,457,940 V2643A unknown Het
Map4k5 A G 12: 69,850,824 probably benign Het
Mecom A T 3: 30,238,119 D14E Het
Myo3a G T 2: 22,558,307 K969N possibly damaging Het
Nat3 T C 8: 67,547,550 I27T probably damaging Het
Nr1d1 G C 11: 98,769,247 R484G probably damaging Het
Nr2c1 T C 10: 94,195,257 L560P probably damaging Het
Olfr671 T C 7: 104,975,118 N293S probably damaging Het
Pik3cg T C 12: 32,205,007 D327G probably damaging Het
Ppp1r13l G T 7: 19,370,056 G154V probably damaging Het
Psmc5 A G 11: 106,262,861 D382G probably benign Het
Ptprz1 C A 6: 22,972,717 Q209K possibly damaging Het
Rev1 A C 1: 38,059,272 L730R probably damaging Het
Rin3 G A 12: 102,373,602 V684I probably damaging Het
Secisbp2 G A 13: 51,679,833 V670I possibly damaging Het
Sema6d G A 2: 124,655,214 C136Y probably damaging Het
Sf3a2 T A 10: 80,804,304 H316Q unknown Het
Sp100 T C 1: 85,662,564 V93A possibly damaging Het
Spta1 C T 1: 174,213,374 L1247F probably damaging Het
Syne1 T A 10: 5,194,618 N21I probably damaging Het
Tbck G T 3: 132,686,826 M9I probably benign Het
Tln2 T C 9: 67,367,218 Y376C probably damaging Het
Tmem199 T A 11: 78,507,807 probably benign Het
Ttf2 A G 3: 100,950,332 L759P probably damaging Het
Ubqlnl T A 7: 104,149,999 H97L probably damaging Het
Zfp800 T C 6: 28,244,271 I232V probably benign Het
Zfp831 A G 2: 174,646,081 T850A probably benign Het
Other mutations in Ror1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00838:Ror1 APN 4 100333743 missense probably damaging 1.00
IGL00939:Ror1 APN 4 100441226 missense probably benign 0.01
IGL01408:Ror1 APN 4 100333787 missense probably damaging 1.00
IGL01678:Ror1 APN 4 100425968 missense possibly damaging 0.68
IGL01700:Ror1 APN 4 100409771 missense probably damaging 1.00
IGL01985:Ror1 APN 4 100425964 missense possibly damaging 0.94
IGL02002:Ror1 APN 4 100441184 missense probably damaging 1.00
IGL02634:Ror1 APN 4 100426110 missense probably benign 0.00
IGL02995:Ror1 APN 4 100334525 splice site probably benign
IGL03033:Ror1 APN 4 100411895 missense possibly damaging 0.67
IGL03207:Ror1 APN 4 100407945 splice site probably null
F5770:Ror1 UTSW 4 100440933 missense probably damaging 0.99
R0256:Ror1 UTSW 4 100409745 missense probably benign 0.20
R0417:Ror1 UTSW 4 100412000 missense possibly damaging 0.94
R0525:Ror1 UTSW 4 100441520 missense probably damaging 1.00
R1034:Ror1 UTSW 4 100333620 nonsense probably null
R1278:Ror1 UTSW 4 100441878 missense possibly damaging 0.69
R1368:Ror1 UTSW 4 100441137 missense possibly damaging 0.94
R1437:Ror1 UTSW 4 100412109 missense probably benign
R1441:Ror1 UTSW 4 100440983 missense probably benign
R1544:Ror1 UTSW 4 100441986 missense probably damaging 1.00
R1717:Ror1 UTSW 4 100302938 missense probably benign
R1857:Ror1 UTSW 4 100441503 missense probably damaging 1.00
R2018:Ror1 UTSW 4 100407841 nonsense probably null
R2051:Ror1 UTSW 4 100407868 nonsense probably null
R2127:Ror1 UTSW 4 100442093 missense probably benign
R2132:Ror1 UTSW 4 100410025 missense probably benign 0.35
R2133:Ror1 UTSW 4 100410025 missense probably benign 0.35
R2176:Ror1 UTSW 4 100441874 missense probably damaging 0.99
R2431:Ror1 UTSW 4 100441155 missense probably damaging 1.00
R2896:Ror1 UTSW 4 100096280 missense unknown
R3005:Ror1 UTSW 4 100441764 missense probably damaging 0.99
R3780:Ror1 UTSW 4 100412117 missense probably benign 0.34
R3850:Ror1 UTSW 4 100442160 missense possibly damaging 0.90
R3861:Ror1 UTSW 4 100407923 missense possibly damaging 0.46
R4599:Ror1 UTSW 4 100407910 missense probably damaging 0.99
R4863:Ror1 UTSW 4 100409804 missense probably damaging 0.99
R4871:Ror1 UTSW 4 100425998 missense probably benign
R4990:Ror1 UTSW 4 100441964 missense probably benign
R5023:Ror1 UTSW 4 100425932 missense probably benign 0.01
R5028:Ror1 UTSW 4 100411936 missense possibly damaging 0.67
R5079:Ror1 UTSW 4 100441422 missense probably damaging 1.00
R5294:Ror1 UTSW 4 100425938 missense probably benign 0.00
R5538:Ror1 UTSW 4 100441011 missense probably benign
R6339:Ror1 UTSW 4 100411931 missense possibly damaging 0.91
R6491:Ror1 UTSW 4 100409912 missense possibly damaging 0.94
R6632:Ror1 UTSW 4 100442106 missense probably benign
R6733:Ror1 UTSW 4 100426055 missense probably benign
R7022:Ror1 UTSW 4 100407911 missense probably damaging 1.00
R7054:Ror1 UTSW 4 100442239 missense probably benign 0.00
R7121:Ror1 UTSW 4 100302945 missense probably benign 0.00
R7350:Ror1 UTSW 4 100425943 missense probably benign 0.00
R7492:Ror1 UTSW 4 100441059 missense probably benign 0.22
R7502:Ror1 UTSW 4 100333630 missense probably benign 0.03
R7531:Ror1 UTSW 4 100441191 missense probably damaging 1.00
R7661:Ror1 UTSW 4 100441490 missense probably damaging 1.00
R7822:Ror1 UTSW 4 100441367 missense probably damaging 1.00
R7831:Ror1 UTSW 4 100441098 missense probably benign 0.01
R8366:Ror1 UTSW 4 100409998 missense possibly damaging 0.91
R8539:Ror1 UTSW 4 100441887 missense possibly damaging 0.71
R8862:Ror1 UTSW 4 100334518 critical splice donor site probably null
R8913:Ror1 UTSW 4 100407830 missense possibly damaging 0.89
V7580:Ror1 UTSW 4 100440933 missense probably damaging 0.99
V7583:Ror1 UTSW 4 100440933 missense probably damaging 0.99
X0020:Ror1 UTSW 4 100426090 missense probably benign 0.02
Z1177:Ror1 UTSW 4 100302919 nonsense probably null
Predicted Primers PCR Primer
(F):5'- TGACAAGCGTCGTACCATTAC -3'
(R):5'- CAAAGAGCATACACACAGGTTG -3'

Sequencing Primer
(F):5'- AAGCGTCGTACCATTACCTTCAG -3'
(R):5'- TTCCTGGGTGACGGCTC -3'
Posted On2021-04-30