Mutagenetix > Incidental Mutation

Incidental Mutation 'R6339:Ror1'

513808

Institutional Source

Beutler Lab

Gene Symbol

Ror1

Ensembl Gene

ENSMUSG00000035305

Gene Name

receptor tyrosine kinase-like orphan receptor 1

Synonyms

2810404D04Rik, Ntrkr1

MMRRC Submission

044493-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R6339 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

100095791-100444765 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to T at 100411931 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Arginine to Leucine at position 322 (R322L)

Ref Sequence

ENSEMBL: ENSMUSP00000048171 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000039630]

AlphaFold

Q9Z139

Predicted Effect

possibly damaging
Transcript: ENSMUST00000039630
AA Change: R322L

PolyPhen 2 Score 0.907 (Sensitivity: 0.81; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000048171
Gene: ENSMUSG00000035305
AA Change: R322L

Domain	Start	End	E-Value	Type
signal peptide	1	29	N/A	INTRINSIC
IGc2	70	138	8.37e-15	SMART
Pfam:Fz	170	290	4.9e-13	PFAM
KR	311	393	7.57e-47	SMART
transmembrane domain	404	426	N/A	INTRINSIC
TyrKc	473	746	2.46e-137	SMART
low complexity region	753	762	N/A	INTRINSIC
low complexity region	817	828	N/A	INTRINSIC
low complexity region	849	864	N/A	INTRINSIC

Meta Mutation Damage Score

0.9027

Coding Region Coverage

1x: 100.0%
3x: 99.7%
10x: 98.2%
20x: 94.1%

Validation Efficiency

97% (69/71)

MGI Phenotype

FUNCTION: This gene encodes a receptor tyrosine kinase that has been implicated in nervous system development, specifically in the maintenance of neural progenitor cell fate, neurite extension and synapse formation. The encoded protein, likely a pseudokinase that lacks catalytic activity, may also regulate adipogenesis. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Aug 2015]
PHENOTYPE: Mice homozygous for some disruptions in this gene die within the first day after birth from respiratory defects. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 71 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4931408C20Rik	T	A	1: 26,682,505	D1198V	probably benign	Het
4933424G06Rik	A	T	1: 36,710,461		probably benign	Het
Adgrg6	G	T	10: 14,434,347	S743R	probably damaging	Het
Ak8	A	G	2: 28,734,448		probably null	Het
Alpk2	A	G	18: 65,349,806	M377T	probably benign	Het
Ap1g1	G	A	8: 109,844,368	V425I	possibly damaging	Het
Apob	A	T	12: 8,016,188	R4353W	probably damaging	Het
Arhgef38	T	C	3: 133,133,662	K540R	probably benign	Het
AY761184	G	A	8: 21,703,469	S45F	possibly damaging	Het
B3galt2	A	T	1: 143,646,902	T259S	possibly damaging	Het
Btbd8	G	A	5: 107,503,717	V159I	probably benign	Het
C2cd2l	T	C	9: 44,313,491		probably benign	Het
Carmil3	T	C	14: 55,499,849	V763A	possibly damaging	Het
Ccdc171	A	T	4: 83,742,997	T1115S	probably damaging	Het
Chst2	C	T	9: 95,405,750	G181D	probably damaging	Het
Col7a1	C	T	9: 108,956,633	T390M	unknown	Het
Cpt1a	A	C	19: 3,362,152	D208A	probably benign	Het
Crocc2	A	G	1: 93,214,032	E1183G	probably benign	Het
Dlg5	T	A	14: 24,158,060	H1003L	probably damaging	Het
Dok2	A	T	14: 70,775,718	I109L	probably benign	Het
Dpy19l4	A	T	4: 11,285,111	I465K	probably damaging	Het
Dync1h1	A	T	12: 110,646,205	D2838V	probably damaging	Het
Frem3	A	G	8: 80,613,015	R646G	possibly damaging	Het
Gcfc2	T	A	6: 81,946,496	F514I	probably damaging	Het
Gm8104	T	C	14: 43,101,485	M44T	probably benign	Het
Golph3l	T	A	3: 95,617,439	W334R	probably damaging	Het
Gpr179	A	T	11: 97,344,176	F443I	probably damaging	Het
Ift172	A	G	5: 31,256,583	V1467A	probably benign	Het
Ift172	A	T	5: 31,286,945	D44E	probably damaging	Het
Il1rl1	C	T	1: 40,461,856	A464V	possibly damaging	Het
Irx5	A	G	8: 92,359,853	E188G	probably damaging	Het
Jak1	A	G	4: 101,161,926	V710A	probably damaging	Het
Kcng4	A	T	8: 119,632,954	F228I	probably damaging	Het
Lifr	A	G	15: 7,167,049	N238S	probably benign	Het
Ltbp3	C	A	19: 5,747,477	H414Q	probably damaging	Het
Mcpt8	A	G	14: 56,082,337	C219R	probably benign	Het
Mepce	A	T	5: 137,785,688	N125K	possibly damaging	Het
Mfap3	T	C	11: 57,529,772	F193S	probably damaging	Het
Miox	T	A	15: 89,335,499	Y63*	probably null	Het
Msl2	A	T	9: 101,101,750	H441L	probably benign	Het
Nemp2	T	A	1: 52,640,910	S98T	possibly damaging	Het
Neto2	G	T	8: 85,640,558	A547E	probably benign	Het
Nol12	T	C	15: 78,940,833		probably benign	Het
Npr3	T	C	15: 11,845,275	I504V	probably damaging	Het
Olfr1204	A	G	2: 88,852,871	D307G	probably null	Het
Pcdhb3	T	C	18: 37,300,945		probably benign	Het
Pear1	C	A	3: 87,752,520	G720W	probably damaging	Het
Pibf1	T	G	14: 99,107,398	D151E	probably damaging	Het
Pla2g6	T	A	15: 79,308,816	N217I	probably damaging	Het
Plcd1	G	A	9: 119,074,991	R292C	probably damaging	Het
Plcl1	C	T	1: 55,696,315	L272F	probably damaging	Het
Ppp4r4	A	T	12: 103,604,969	K656*	probably null	Het
Prr22	G	A	17: 56,771,490	M214I	probably benign	Het
Sh3tc2	G	A	18: 61,975,571	W244*	probably null	Het
Slamf6	A	G	1: 171,948,048	N320S	probably null	Het
Slc1a6	A	C	10: 78,800,085	D328A	possibly damaging	Het
Sorl1	G	T	9: 41,969,742	T2161K	probably benign	Het
Sstr2	T	C	11: 113,624,549	F98S	probably damaging	Het
Stk33	A	T	7: 109,321,465	D348E	probably benign	Het
Sulf1	T	A	1: 12,838,440	L559Q	probably damaging	Het
Syne2	A	G	12: 75,989,153	D3738G	probably benign	Het
Taok3	A	T	5: 117,228,030	Q382L	probably benign	Het
Tet2	T	A	3: 133,486,417	H752L	possibly damaging	Het
Tia1	A	C	6: 86,426,656	K285T	probably damaging	Het
Tle3	G	T	9: 61,401,924		probably null	Het
Top1mt	T	C	15: 75,665,656	T414A	possibly damaging	Het
Ubc	A	T	5: 125,387,342	I307N	probably damaging	Het
Vmn2r96	A	T	17: 18,583,862	D266V	possibly damaging	Het
Wbp2nl	G	T	15: 82,299,045	W13C	possibly damaging	Het
Zfp456	T	A	13: 67,362,364	K102*	probably null	Het
Zkscan1	T	C	5: 138,093,305	V100A	probably damaging	Het

Other mutations in Ror1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00838:Ror1	APN	4	100333743	missense	probably damaging	1.00
IGL00939:Ror1	APN	4	100441226	missense	probably benign	0.01
IGL01408:Ror1	APN	4	100333787	missense	probably damaging	1.00
IGL01678:Ror1	APN	4	100425968	missense	possibly damaging	0.68
IGL01700:Ror1	APN	4	100409771	missense	probably damaging	1.00
IGL01985:Ror1	APN	4	100425964	missense	possibly damaging	0.94
IGL02002:Ror1	APN	4	100441184	missense	probably damaging	1.00
IGL02634:Ror1	APN	4	100426110	missense	probably benign	0.00
IGL02995:Ror1	APN	4	100334525	splice site	probably benign
IGL03033:Ror1	APN	4	100411895	missense	possibly damaging	0.67
IGL03207:Ror1	APN	4	100407945	splice site	probably null
F5770:Ror1	UTSW	4	100440933	missense	probably damaging	0.99
R0256:Ror1	UTSW	4	100409745	missense	probably benign	0.20
R0417:Ror1	UTSW	4	100412000	missense	possibly damaging	0.94
R0525:Ror1	UTSW	4	100441520	missense	probably damaging	1.00
R1034:Ror1	UTSW	4	100333620	nonsense	probably null
R1278:Ror1	UTSW	4	100441878	missense	possibly damaging	0.69
R1368:Ror1	UTSW	4	100441137	missense	possibly damaging	0.94
R1437:Ror1	UTSW	4	100412109	missense	probably benign
R1441:Ror1	UTSW	4	100440983	missense	probably benign
R1544:Ror1	UTSW	4	100441986	missense	probably damaging	1.00
R1717:Ror1	UTSW	4	100302938	missense	probably benign
R1857:Ror1	UTSW	4	100441503	missense	probably damaging	1.00
R2018:Ror1	UTSW	4	100407841	nonsense	probably null
R2051:Ror1	UTSW	4	100407868	nonsense	probably null
R2127:Ror1	UTSW	4	100442093	missense	probably benign
R2132:Ror1	UTSW	4	100410025	missense	probably benign	0.35
R2133:Ror1	UTSW	4	100410025	missense	probably benign	0.35
R2176:Ror1	UTSW	4	100441874	missense	probably damaging	0.99
R2431:Ror1	UTSW	4	100441155	missense	probably damaging	1.00
R2896:Ror1	UTSW	4	100096280	missense	unknown
R3005:Ror1	UTSW	4	100441764	missense	probably damaging	0.99
R3780:Ror1	UTSW	4	100412117	missense	probably benign	0.34
R3850:Ror1	UTSW	4	100442160	missense	possibly damaging	0.90
R3861:Ror1	UTSW	4	100407923	missense	possibly damaging	0.46
R4599:Ror1	UTSW	4	100407910	missense	probably damaging	0.99
R4863:Ror1	UTSW	4	100409804	missense	probably damaging	0.99
R4871:Ror1	UTSW	4	100425998	missense	probably benign
R4990:Ror1	UTSW	4	100441964	missense	probably benign
R5023:Ror1	UTSW	4	100425932	missense	probably benign	0.01
R5028:Ror1	UTSW	4	100411936	missense	possibly damaging	0.67
R5079:Ror1	UTSW	4	100441422	missense	probably damaging	1.00
R5294:Ror1	UTSW	4	100425938	missense	probably benign	0.00
R5538:Ror1	UTSW	4	100441011	missense	probably benign
R6491:Ror1	UTSW	4	100409912	missense	possibly damaging	0.94
R6632:Ror1	UTSW	4	100442106	missense	probably benign
R6733:Ror1	UTSW	4	100426055	missense	probably benign
R7022:Ror1	UTSW	4	100407911	missense	probably damaging	1.00
R7054:Ror1	UTSW	4	100442239	missense	probably benign	0.00
R7121:Ror1	UTSW	4	100302945	missense	probably benign	0.00
R7350:Ror1	UTSW	4	100425943	missense	probably benign	0.00
R7492:Ror1	UTSW	4	100441059	missense	probably benign	0.22
R7502:Ror1	UTSW	4	100333630	missense	probably benign	0.03
R7531:Ror1	UTSW	4	100441191	missense	probably damaging	1.00
R7661:Ror1	UTSW	4	100441490	missense	probably damaging	1.00
R7822:Ror1	UTSW	4	100441367	missense	probably damaging	1.00
R7831:Ror1	UTSW	4	100441098	missense	probably benign	0.01
R8366:Ror1	UTSW	4	100409998	missense	possibly damaging	0.91
R8539:Ror1	UTSW	4	100441887	missense	possibly damaging	0.71
R8757:Ror1	UTSW	4	100440883	missense	probably benign	0.01
R8862:Ror1	UTSW	4	100334518	critical splice donor site	probably null
R8913:Ror1	UTSW	4	100407830	missense	possibly damaging	0.89
R9382:Ror1	UTSW	4	100334512	missense	probably benign	0.00
V7580:Ror1	UTSW	4	100440933	missense	probably damaging	0.99
V7583:Ror1	UTSW	4	100440933	missense	probably damaging	0.99
X0020:Ror1	UTSW	4	100426090	missense	probably benign	0.02
Z1177:Ror1	UTSW	4	100302919	nonsense	probably null

Predicted Primers

PCR Primer
(F):5'- TGCACTAATCTGCCTGGAGAAAG -3'
(R):5'- TAACTTCTATTTACCACATGCTGGG -3'

Sequencing Primer
(F):5'- TCTGCCTGGAGAAAGACCTTC -3'
(R):5'- TACCACATGCTGGGATGTCAC -3'

Posted On

2018-04-27