Incidental Mutation 'T0975:Cxxc1'
ID67742
Institutional Source Beutler Lab
Gene Symbol Cxxc1
Ensembl Gene ENSMUSG00000024560
Gene NameCXXC finger 1 (PHD domain)
Synonyms2410002I16Rik, 5830420C16Rik, PHF18, Cgbp, Cfp1
Accession Numbers

Ncbi RefSeq: NM_028868.3; MGI:1921572

Is this an essential gene? Essential (E-score: 1.000) question?
Stock #T0975 (G3) of strain 714
Quality Score225
Status Not validated
Chromosome18
Chromosomal Location74216131-74221491 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 74220921 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Cysteine at position 593 (R593C)
Ref Sequence ENSEMBL: ENSMUSP00000025444 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025444]
Predicted Effect probably damaging
Transcript: ENSMUST00000025444
AA Change: R593C

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000025444
Gene: ENSMUSG00000024560
AA Change: R593C

DomainStartEndE-ValueType
PHD 28 74 1.26e-10 SMART
Pfam:zf-CXXC 164 212 2.4e-19 PFAM
low complexity region 237 253 N/A INTRINSIC
low complexity region 272 282 N/A INTRINSIC
low complexity region 325 364 N/A INTRINSIC
Pfam:zf-CpG_bind_C 404 640 2.1e-108 PFAM
Meta Mutation Damage Score 0.6546 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.7%
  • 10x: 97.0%
  • 20x: 93.3%
Validation Efficiency
MGI Phenotype Strain: 2654854
Lethality: E1-E7
FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that functions as a transcriptional activator that binds specifically to non-methylated CpG motifs through its CXXC domain. The protein is a component of the SETD1 complex, regulates gene expression and is essential for vertebrate development. [provided by RefSeq, Sep 2015]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit peri-implantation lethality and failure to gastrulate. [provided by MGI curators]
Allele List at MGI

All alleles(3) : Targeted(2) Gene trapped(1)
 

Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930556J24Rik TAA TAAA 11: 3,937,945 probably null Het
4930556J24Rik C T 11: 3,976,324 A27T unknown Het
Ago3 C T 4: 126,404,263 V155I probably benign Het
Ago3 C T 4: 126,404,305 A141T probably benign Het
Ago3 G A 4: 126,404,310 A139V probably benign Het
Ahdc1 ACCTCCT ACCTCCTCCT 4: 133,062,754 probably benign Het
Azin2 A G 4: 128,946,134 Y222H probably benign Het
Bpifb5 C A 2: 154,229,464 probably null Het
Ccdc157 C T 11: 4,146,246 A455T probably damaging Het
Ccng1 A C 11: 40,754,044 S9A probably benign Het
Cfh T C 1: 140,154,598 T164A probably benign Het
Cherp TTGGACCTGGACCTGGACCTGGACCTGGA TTGGACCTGGACCTGGACCTGGA 8: 72,462,034 probably benign Het
Chrng T C 1: 87,210,626 S380P probably benign Het
Clspn ACGGCGGCGGCGGCG ACGGCGGCGGCGGCGGCGGCG 4: 126,566,437 probably benign Het
Ctrc T TA 4: 141,845,196 probably null Het
Dlgap1 T C 17: 70,516,955 S312P possibly damaging Het
Dnah10 A G 5: 124,763,066 S1255G probably benign Het
Dpep1 A T 8: 123,200,988 S388C probably damaging Het
Emid1 A C 11: 5,128,884 L353V probably benign Het
Emid1 T C 11: 5,144,386 T42A probably damaging Het
Epn3 A G 11: 94,491,907 probably null Het
Fam124b T C 1: 80,213,126 E180G probably benign Het
Fam135b T G 15: 71,463,885 T487P probably damaging Het
Gatsl3 G C 11: 4,220,445 G147A probably benign Het
Gja4 G C 4: 127,312,231 H246Q probably benign Het
Gm7534 GTG GTGCTG 4: 134,202,629 probably benign Het
Gm9972 GA GAA 11: 43,036,770 probably null Het
Hmmr G C 11: 40,723,416 N148K probably damaging Het
Homez C T 14: 54,857,339 R304K possibly damaging Het
Ifngr1 G A 10: 19,609,473 V407M probably damaging Het
Inpp5j G T 11: 3,502,527 T241N possibly damaging Het
Kif12 GGGGC GGGGCCTCCACCCGGCGGGC 4: 63,171,423 probably benign Het
Kremen1 C T 11: 5,195,105 A424T probably benign Het
Mat2b G A 11: 40,680,091 T302I probably benign Het
Mtmr3 C T 11: 4,488,441 R671K probably benign Het
Nacad GCAGGGTCAGGGTC GCAGGGTCAGGGTCAGGGTC 11: 6,599,750 probably benign Het
Nacad T C 11: 6,601,622 N523S probably benign Het
Nacad A G 11: 6,601,632 C520R probably benign Het
Nefh G A 11: 4,940,151 P823S probably benign Het
Nfrkb G C 9: 31,397,083 A230P probably benign Het
Nlrp4a A G 7: 26,449,637 E223G probably damaging Het
Notch3 T A 17: 32,146,417 Y1107F probably damaging Het
Olfr1331 G T 4: 118,869,303 R174M probably benign Het
Olfr309 A T 7: 86,306,284 Y276* probably null Het
Olfr781 A G 10: 129,333,445 D188G probably benign Het
Osm A G 11: 4,239,588 D124G probably benign Het
Plekhm2 TTCCTCCTCCT TTCCTCCT 4: 141,631,981 probably benign Het
Pomgnt1 C T 4: 116,137,427 probably benign Het
Spen A G 4: 141,474,353 V2321A probably benign Het
Sytl1 TCTGC TC 4: 133,256,994 probably benign Het
Tcn2 G C 11: 3,923,487 F286L possibly damaging Het
Tg T C 15: 66,688,863 S10P probably benign Het
Tmprss7 C T 16: 45,680,733 R235Q probably benign Het
Tns3 G T 11: 8,451,146 L1051M probably benign Het
Tns3 T G 11: 8,479,518 E806A probably benign Het
Tns3 G A 11: 8,549,100 probably benign Het
Toe1 T C 4: 116,806,093 I62M probably benign Het
Txnrd2 A G 16: 18,475,565 H436R probably damaging Het
Ubr4 C T 4: 139,451,781 P2001S probably damaging Het
Vmn2r23 T A 6: 123,713,161 M332K probably benign Het
Zbtb8a GG GGATG 4: 129,360,019 probably benign Het
Zbtb8a T C 4: 129,360,212 H163R probably benign Het
Zfyve21 A G 12: 111,827,633 D206G probably damaging Het
Zkscan4 AGAGGAG AGAG 13: 21,479,200 probably benign Het
Zmym1 C T 4: 127,047,947 D785N probably benign Het
Zmym1 C T 4: 127,048,250 V684I probably benign Het
Zmym1 A C 4: 127,049,673 H307Q probably benign Het
Other mutations in Cxxc1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01477:Cxxc1 APN 18 74219914 missense possibly damaging 0.83
IGL02250:Cxxc1 APN 18 74219169 missense probably benign 0.00
IGL02640:Cxxc1 APN 18 74221183 missense probably damaging 1.00
IGL02802:Cxxc1 UTSW 18 74219410 nonsense probably null
P0018:Cxxc1 UTSW 18 74220921 missense probably damaging 1.00
R0534:Cxxc1 UTSW 18 74218891 missense probably benign 0.00
R0557:Cxxc1 UTSW 18 74218774 missense possibly damaging 0.92
R0576:Cxxc1 UTSW 18 74220185 missense possibly damaging 0.47
R0673:Cxxc1 UTSW 18 74218913 missense possibly damaging 0.92
R1539:Cxxc1 UTSW 18 74219207 missense possibly damaging 0.53
R1714:Cxxc1 UTSW 18 74219863 missense probably damaging 1.00
R4763:Cxxc1 UTSW 18 74219413 missense probably damaging 0.98
R5252:Cxxc1 UTSW 18 74219951 missense probably benign 0.30
R5890:Cxxc1 UTSW 18 74221166 missense possibly damaging 0.68
R6908:Cxxc1 UTSW 18 74220559 missense probably damaging 1.00
R7064:Cxxc1 UTSW 18 74220607 critical splice donor site probably null
R7305:Cxxc1 UTSW 18 74219396 missense probably benign 0.02
R7404:Cxxc1 UTSW 18 74219207 missense possibly damaging 0.95
R7790:Cxxc1 UTSW 18 74217784 missense probably damaging 0.99
X0028:Cxxc1 UTSW 18 74218801 missense probably benign
Predicted Primers PCR Primer
(F):5'- AGCAAGACATATTGTAAGCGGCTCC -3'
(R):5'- AGCTTGTACCACTGCCAAGGAAATG -3'

Sequencing Primer
(F):5'- tcttttcctccttcttccttcc -3'
(R):5'- CACTGCCAAGGAAATGGAAGG -3'
Posted On2013-09-03