Incidental Mutation 'T0975:Kremen1'
ID262180
Institutional Source Beutler Lab
Gene Symbol Kremen1
Ensembl Gene ENSMUSG00000020393
Gene Namekringle containing transmembrane protein 1
SynonymsKrm1
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.112) question?
Stock #T0975 (G3) of strain 714
Quality Score151
Status Not validated
Chromosome11
Chromosomal Location5191552-5261558 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 5195105 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Threonine at position 424 (A424T)
Ref Sequence ENSEMBL: ENSMUSP00000020662 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020662]
Predicted Effect probably benign
Transcript: ENSMUST00000020662
AA Change: A424T

PolyPhen 2 Score 0.021 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000020662
Gene: ENSMUSG00000020393
AA Change: A424T

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
KR 30 116 9.81e-23 SMART
Pfam:WSC 119 200 3.7e-21 PFAM
CUB 214 321 4.27e-19 SMART
transmembrane domain 391 413 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.7%
  • 10x: 97.0%
  • 20x: 93.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a high-affinity dickkopf homolog 1 (DKK1) transmembrane receptor that functionally cooperates with DKK1 to block wingless (WNT)/beta-catenin signaling. The encoded protein is a component of a membrane complex that modulates canonical WNT signaling through lipoprotein receptor-related protein 6 (LRP6). It contains extracellular kringle, WSC, and CUB domains. Alternatively spliced transcript variants encoding distinct isoforms have been observed for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null allele exhibit no abnormal phenotype. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930556J24Rik TAA TAAA 11: 3,937,945 probably null Het
4930556J24Rik C T 11: 3,976,324 A27T unknown Het
Ago3 C T 4: 126,404,263 V155I probably benign Het
Ago3 C T 4: 126,404,305 A141T probably benign Het
Ago3 G A 4: 126,404,310 A139V probably benign Het
Ahdc1 ACCTCCT ACCTCCTCCT 4: 133,062,754 probably benign Het
Azin2 A G 4: 128,946,134 Y222H probably benign Het
Bpifb5 C A 2: 154,229,464 probably null Het
Ccdc157 C T 11: 4,146,246 A455T probably damaging Het
Ccng1 A C 11: 40,754,044 S9A probably benign Het
Cfh T C 1: 140,154,598 T164A probably benign Het
Cherp TTGGACCTGGACCTGGACCTGGACCTGGA TTGGACCTGGACCTGGACCTGGA 8: 72,462,034 probably benign Het
Chrng T C 1: 87,210,626 S380P probably benign Het
Clspn ACGGCGGCGGCGGCG ACGGCGGCGGCGGCGGCGGCG 4: 126,566,437 probably benign Het
Ctrc T TA 4: 141,845,196 probably null Het
Cxxc1 C T 18: 74,220,921 R593C probably damaging Het
Dlgap1 T C 17: 70,516,955 S312P possibly damaging Het
Dnah10 A G 5: 124,763,066 S1255G probably benign Het
Dpep1 A T 8: 123,200,988 S388C probably damaging Het
Emid1 A C 11: 5,128,884 L353V probably benign Het
Emid1 T C 11: 5,144,386 T42A probably damaging Het
Epn3 A G 11: 94,491,907 probably null Het
Fam124b T C 1: 80,213,126 E180G probably benign Het
Fam135b T G 15: 71,463,885 T487P probably damaging Het
Gatsl3 G C 11: 4,220,445 G147A probably benign Het
Gja4 G C 4: 127,312,231 H246Q probably benign Het
Gm7534 GTG GTGCTG 4: 134,202,629 probably benign Het
Gm9972 GA GAA 11: 43,036,770 probably null Het
Hmmr G C 11: 40,723,416 N148K probably damaging Het
Homez C T 14: 54,857,339 R304K possibly damaging Het
Ifngr1 G A 10: 19,609,473 V407M probably damaging Het
Inpp5j G T 11: 3,502,527 T241N possibly damaging Het
Kif12 GGGGC GGGGCCTCCACCCGGCGGGC 4: 63,171,423 probably benign Het
Mat2b G A 11: 40,680,091 T302I probably benign Het
Mtmr3 C T 11: 4,488,441 R671K probably benign Het
Nacad GCAGGGTCAGGGTC GCAGGGTCAGGGTCAGGGTC 11: 6,599,750 probably benign Het
Nacad T C 11: 6,601,622 N523S probably benign Het
Nacad A G 11: 6,601,632 C520R probably benign Het
Nefh G A 11: 4,940,151 P823S probably benign Het
Nfrkb G C 9: 31,397,083 A230P probably benign Het
Nlrp4a A G 7: 26,449,637 E223G probably damaging Het
Notch3 T A 17: 32,146,417 Y1107F probably damaging Het
Olfr1331 G T 4: 118,869,303 R174M probably benign Het
Olfr309 A T 7: 86,306,284 Y276* probably null Het
Olfr781 A G 10: 129,333,445 D188G probably benign Het
Osm A G 11: 4,239,588 D124G probably benign Het
Plekhm2 TTCCTCCTCCT TTCCTCCT 4: 141,631,981 probably benign Het
Pomgnt1 C T 4: 116,137,427 probably benign Het
Spen A G 4: 141,474,353 V2321A probably benign Het
Sytl1 TCTGC TC 4: 133,256,994 probably benign Het
Tcn2 G C 11: 3,923,487 F286L possibly damaging Het
Tg T C 15: 66,688,863 S10P probably benign Het
Tmprss7 C T 16: 45,680,733 R235Q probably benign Het
Tns3 G T 11: 8,451,146 L1051M probably benign Het
Tns3 T G 11: 8,479,518 E806A probably benign Het
Tns3 G A 11: 8,549,100 probably benign Het
Toe1 T C 4: 116,806,093 I62M probably benign Het
Txnrd2 A G 16: 18,475,565 H436R probably damaging Het
Ubr4 C T 4: 139,451,781 P2001S probably damaging Het
Vmn2r23 T A 6: 123,713,161 M332K probably benign Het
Zbtb8a GG GGATG 4: 129,360,019 probably benign Het
Zbtb8a T C 4: 129,360,212 H163R probably benign Het
Zfyve21 A G 12: 111,827,633 D206G probably damaging Het
Zkscan4 AGAGGAG AGAG 13: 21,479,200 probably benign Het
Zmym1 C T 4: 127,047,947 D785N probably benign Het
Zmym1 C T 4: 127,048,250 V684I probably benign Het
Zmym1 A C 4: 127,049,673 H307Q probably benign Het
Other mutations in Kremen1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01813:Kremen1 APN 11 5199667 missense probably benign 0.00
R0038:Kremen1 UTSW 11 5207703 splice site probably benign
R0511:Kremen1 UTSW 11 5215447 missense probably damaging 1.00
R1557:Kremen1 UTSW 11 5215373 intron probably null
R1579:Kremen1 UTSW 11 5201791 unclassified probably benign
R1729:Kremen1 UTSW 11 5201791 unclassified probably benign
R1784:Kremen1 UTSW 11 5201792 unclassified probably benign
R1800:Kremen1 UTSW 11 5201791 unclassified probably benign
R2079:Kremen1 UTSW 11 5201794 frame shift probably null
R2100:Kremen1 UTSW 11 5201788 unclassified probably benign
R2286:Kremen1 UTSW 11 5201791 unclassified probably benign
R2298:Kremen1 UTSW 11 5201788 unclassified probably benign
R2352:Kremen1 UTSW 11 5201791 unclassified probably benign
R2512:Kremen1 UTSW 11 5201791 unclassified probably benign
R2761:Kremen1 UTSW 11 5201792 unclassified probably benign
R2846:Kremen1 UTSW 11 5201793 unclassified probably benign
R2882:Kremen1 UTSW 11 5201791 unclassified probably benign
R2944:Kremen1 UTSW 11 5201791 unclassified probably benign
R2980:Kremen1 UTSW 11 5201794 unclassified probably benign
R3151:Kremen1 UTSW 11 5195012 missense probably damaging 0.99
R3610:Kremen1 UTSW 11 5201791 unclassified probably benign
R3831:Kremen1 UTSW 11 5201794 unclassified probably benign
R3957:Kremen1 UTSW 11 5201791 unclassified probably benign
R4231:Kremen1 UTSW 11 5243881 nonsense probably null
R4397:Kremen1 UTSW 11 5199610 missense probably benign 0.36
R5627:Kremen1 UTSW 11 5199709 missense probably benign 0.01
R6818:Kremen1 UTSW 11 5195051 missense probably benign 0.02
R7584:Kremen1 UTSW 11 5194964 missense possibly damaging 0.95
Y4339:Kremen1 UTSW 11 5201791 unclassified probably benign
Predicted Primers
Posted On2015-02-04