Incidental Mutation 'R8967:Cpxm2'
ID 682805
Institutional Source Beutler Lab
Gene Symbol Cpxm2
Ensembl Gene ENSMUSG00000030862
Gene Name carboxypeptidase X 2 (M14 family)
Synonyms 4632435C11Rik
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.064) question?
Stock # R8967 (G1)
Quality Score 225.009
Status Validated
Chromosome 7
Chromosomal Location 132032687-132154739 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to T at 132059835 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Asparagine at position 408 (Y408N)
Ref Sequence ENSEMBL: ENSMUSP00000033149 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000033149] [ENSMUST00000124096]
AlphaFold no structure available at present
Predicted Effect probably damaging
Transcript: ENSMUST00000033149
AA Change: Y408N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000033149
Gene: ENSMUSG00000030862
AA Change: Y408N

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
low complexity region 52 59 N/A INTRINSIC
low complexity region 72 82 N/A INTRINSIC
low complexity region 87 98 N/A INTRINSIC
FA58C 143 301 2.18e-46 SMART
Zn_pept 448 736 9.21e-58 SMART
low complexity region 751 764 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000124096
SMART Domains Protein: ENSMUSP00000130971
Gene: ENSMUSG00000030849

DomainStartEndE-ValueType
Pfam:Pkinase 1 118 4.8e-19 PFAM
Pfam:Pkinase_Tyr 1 118 1.7e-50 PFAM
low complexity region 146 160 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.6%
Validation Efficiency 100% (52/52)
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca13 T C 11: 9,292,696 S1520P probably benign Het
Abhd12 A G 2: 150,837,431 Y291H probably damaging Het
Abr C A 11: 76,479,029 S178I possibly damaging Het
Akap13 T A 7: 75,729,134 I422K possibly damaging Het
Arfgef2 A T 2: 166,835,742 T185S probably damaging Het
Arfip2 A T 7: 105,637,134 Y228N probably damaging Het
B4gat1 T C 19: 5,039,650 V225A probably damaging Het
Brf1 G A 12: 112,973,619 P183S probably damaging Het
Ceacam1 T C 7: 25,463,872 N312S possibly damaging Het
Cep135 T C 5: 76,603,318 L337P probably damaging Het
Cnppd1 A T 1: 75,136,621 C334* probably null Het
Dennd3 T C 15: 73,547,577 V739A possibly damaging Het
Dlx3 T C 11: 95,123,751 Y287H probably damaging Het
Dnah7a A T 1: 53,643,435 probably benign Het
Dnah9 C A 11: 66,125,112 probably null Het
Dnajc1 A T 2: 18,308,946 Y121* probably null Het
Ecel1 A T 1: 87,151,140 Y526N probably damaging Het
Ect2 A T 3: 27,144,983 V218E probably damaging Het
Heca A G 10: 17,914,990 probably null Het
Hsd17b7 A T 1: 169,969,116 L6* probably null Het
Irgc1 T A 7: 24,433,312 T27S probably benign Het
Lama3 A C 18: 12,532,039 I671L possibly damaging Het
Mybl2 T C 2: 163,072,886 L308P probably damaging Het
Nicn1 C T 9: 108,294,509 R163C possibly damaging Het
Nphp1 G A 2: 127,740,977 P672L probably damaging Het
Oas3 G A 5: 120,758,842 H905Y probably damaging Het
Obscn A G 11: 59,081,914 V2102A probably benign Het
Olfr1208 A T 2: 88,897,500 Y32* probably null Het
Olfr218 A G 1: 173,203,472 T39A probably benign Het
Olfr352 A T 2: 36,870,054 T163S probably damaging Het
Olfr47 T C 6: 43,236,139 F177S probably damaging Het
Olfr5 A G 7: 6,481,012 L48P possibly damaging Het
Pank4 C G 4: 154,970,958 H262D probably benign Het
Phkb T A 8: 86,029,434 probably benign Het
Pxylp1 G A 9: 96,825,271 T286M probably damaging Het
Pygm A T 19: 6,384,714 D79V probably damaging Het
Rapgef4 A G 2: 72,226,510 T682A possibly damaging Het
Sec24b C T 3: 129,991,435 R974Q probably damaging Het
Serpinb6e A G 13: 33,836,436 F230L possibly damaging Het
Skint6 A T 4: 112,872,504 L850* probably null Het
Slc7a11 C A 3: 50,384,115 V282L probably benign Het
Smg1 A G 7: 118,166,516 S1895P unknown Het
Tango2 A G 16: 18,347,899 probably benign Het
Tmc7 G A 7: 118,561,005 P203L probably benign Het
Tmem64 T A 4: 15,266,575 F208L probably damaging Het
Tpcn1 A T 5: 120,555,958 V191E probably damaging Het
Wdr63 T A 3: 146,055,640 N654Y possibly damaging Het
Zbtb41 A G 1: 139,442,849 I675V probably benign Het
Zfp180 T C 7: 24,105,301 S382P probably damaging Het
Zfp932 A G 5: 110,009,017 S194G probably benign Het
Other mutations in Cpxm2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01862:Cpxm2 APN 7 132059811 missense probably benign 0.01
IGL02039:Cpxm2 APN 7 132047753 missense probably damaging 1.00
IGL03011:Cpxm2 APN 7 132049078 missense possibly damaging 0.46
R0033:Cpxm2 UTSW 7 132062157 missense possibly damaging 0.55
R0100:Cpxm2 UTSW 7 132054871 missense possibly damaging 0.90
R0100:Cpxm2 UTSW 7 132054871 missense possibly damaging 0.90
R0453:Cpxm2 UTSW 7 132128405 missense probably damaging 1.00
R0555:Cpxm2 UTSW 7 132044043 nonsense probably null
R0655:Cpxm2 UTSW 7 132054820 missense possibly damaging 0.87
R0834:Cpxm2 UTSW 7 132154613 intron probably benign
R1145:Cpxm2 UTSW 7 132057648 missense probably damaging 0.99
R1145:Cpxm2 UTSW 7 132057648 missense probably damaging 0.99
R1249:Cpxm2 UTSW 7 132128350 critical splice donor site probably null
R1563:Cpxm2 UTSW 7 132143682 missense probably benign 0.00
R1565:Cpxm2 UTSW 7 132062145 missense probably damaging 1.00
R1709:Cpxm2 UTSW 7 132059834 missense probably damaging 1.00
R1863:Cpxm2 UTSW 7 132143663 splice site probably null
R1874:Cpxm2 UTSW 7 132059834 missense probably damaging 1.00
R1958:Cpxm2 UTSW 7 132062147 missense probably damaging 1.00
R2273:Cpxm2 UTSW 7 132059852 intron probably benign
R3806:Cpxm2 UTSW 7 132080091 missense probably benign 0.12
R3861:Cpxm2 UTSW 7 132054919 missense probably benign 0.00
R4570:Cpxm2 UTSW 7 132143706 missense probably benign 0.11
R4642:Cpxm2 UTSW 7 132070881 missense probably benign 0.11
R4684:Cpxm2 UTSW 7 132049038 missense possibly damaging 0.92
R4717:Cpxm2 UTSW 7 132054845 missense possibly damaging 0.61
R4863:Cpxm2 UTSW 7 132059747 missense probably benign 0.13
R5079:Cpxm2 UTSW 7 132154285 critical splice donor site probably null
R5341:Cpxm2 UTSW 7 132154613 intron probably benign
R5626:Cpxm2 UTSW 7 132059852 intron probably benign
R5666:Cpxm2 UTSW 7 132054896 missense probably benign 0.44
R5815:Cpxm2 UTSW 7 132044110 missense probably damaging 1.00
R6114:Cpxm2 UTSW 7 132154306 missense probably benign
R6133:Cpxm2 UTSW 7 132128453 missense probably damaging 1.00
R6224:Cpxm2 UTSW 7 132143731 missense probably benign
R6468:Cpxm2 UTSW 7 132070860 missense probably damaging 1.00
R6657:Cpxm2 UTSW 7 132049077 missense probably damaging 1.00
R7058:Cpxm2 UTSW 7 132143679 missense probably benign 0.32
R7100:Cpxm2 UTSW 7 132054815 missense probably benign 0.06
R7198:Cpxm2 UTSW 7 132080084 missense probably damaging 1.00
R7712:Cpxm2 UTSW 7 132154378 missense possibly damaging 0.69
R7855:Cpxm2 UTSW 7 132057695 missense possibly damaging 0.56
R7867:Cpxm2 UTSW 7 132049071 missense probably damaging 1.00
R8513:Cpxm2 UTSW 7 132143702 missense probably benign 0.01
R8694:Cpxm2 UTSW 7 132080054 missense probably benign 0.03
R8874:Cpxm2 UTSW 7 132106281 critical splice donor site probably null
RF014:Cpxm2 UTSW 7 132070863 missense possibly damaging 0.85
Z1177:Cpxm2 UTSW 7 132055001 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- GTACTCTCATACATGCACATGC -3'
(R):5'- GGTCGTTTGTGTCCTTCCAAAC -3'

Sequencing Primer
(F):5'- TATCAAAAACAAGAACTAGGCTAAGC -3'
(R):5'- GTGTCCTTCCAAACCTCACCAG -3'
Posted On 2021-10-11