Incidental Mutation 'R9031:Abcc2'
ID 687108
Institutional Source Beutler Lab
Gene Symbol Abcc2
Ensembl Gene ENSMUSG00000025194
Gene Name ATP-binding cassette, sub-family C (CFTR/MRP), member 2
Synonyms multidrug resistance protein 2, Cmoat, Mrp2
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R9031 (G1)
Quality Score 225.009
Status Not validated
Chromosome 19
Chromosomal Location 43782192-43840740 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) G to A at 43822027 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Arginine to Histidine at position 921 (R921H)
Ref Sequence ENSEMBL: ENSMUSP00000026208 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026208]
AlphaFold Q8VI47
Predicted Effect probably benign
Transcript: ENSMUST00000026208
AA Change: R921H

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000026208
Gene: ENSMUSG00000025194
AA Change: R921H

DomainStartEndE-ValueType
transmembrane domain 29 51 N/A INTRINSIC
transmembrane domain 63 85 N/A INTRINSIC
transmembrane domain 100 116 N/A INTRINSIC
transmembrane domain 128 150 N/A INTRINSIC
transmembrane domain 160 182 N/A INTRINSIC
Pfam:ABC_membrane 319 591 3.4e-37 PFAM
low complexity region 597 608 N/A INTRINSIC
AAA 661 836 1.77e-8 SMART
low complexity region 906 933 N/A INTRINSIC
Pfam:ABC_membrane 977 1249 5.4e-48 PFAM
AAA 1324 1509 1.33e-12 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency 100% (81/81)
MGI Phenotype FUNCTION: The membrane-associated protein encoded by this gene is a member of the superfamily of ATP-binding cassette (ABC) transporters. ABC proteins transport various molecules across extra- and intra-cellular membranes. ABC genes are divided into seven distinct subfamilies (ABC1, MDR/TAP, MRP, ALD, OABP, GCN20, White). This protein is a member of the MRP subfamily which is involved in multi-drug resistance. This protein functions in the canalicular surface of the hepatocyte and in biliary transport, and appears to contribute to drug resistance in mammalian cells. Several different mutations in the human gene have been observed in patients with Dubin-Johnson syndrome (DJS), an autosomal recessive disorder characterized by conjugated hyperbilirubinemia. Alternative splice variants have been observed for this gene; however, they have not been fully described. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for disruptions in this gene have moderately enlarged livers, elevated plasma and urine bilirubin, and a reduced ability to clear various drugs and carcinogens from the blood. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 82 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adcy5 A G 16: 35,299,489 I1123V probably damaging Het
Agr2 G C 12: 35,995,566 G17A probably benign Het
Akap6 A T 12: 53,142,048 T2082S probably benign Het
Asxl3 G T 18: 22,524,344 V1804F probably damaging Het
Atat1 A G 17: 35,909,489 V37A probably benign Het
Atp1a3 A T 7: 24,989,787 probably null Het
Bpifb1 A G 2: 154,209,928 T218A probably benign Het
C030006K11Rik T A 15: 76,723,761 Q19L probably benign Het
Ccdc138 T C 10: 58,545,071 F508S probably damaging Het
Ccdc81 T A 7: 89,893,150 M173L probably benign Het
Cdhr1 T C 14: 37,094,019 I141V probably benign Het
Chia1 T C 3: 106,128,461 F206L probably benign Het
Clca3a2 C T 3: 144,805,714 G640E probably damaging Het
Clcn7 T C 17: 25,157,523 V609A probably damaging Het
Col22a1 C A 15: 71,881,674 G126* probably null Het
Cpne7 C T 8: 123,130,212 P402L probably damaging Het
Ctcfl A T 2: 173,117,251 D227E probably benign Het
Cwf19l2 A G 9: 3,417,942 D134G probably benign Het
Cyp2c65 C A 19: 39,073,219 C216* probably null Het
Cyp2d12 T A 15: 82,559,222 C462S probably null Het
Cyp4a12a A C 4: 115,332,002 *509Y probably null Het
Cyp4a12b A G 4: 115,433,668 M298V probably benign Het
Dennd4b T C 3: 90,270,881 V471A probably benign Het
Dlc1 A G 8: 36,937,901 S245P possibly damaging Het
Dnah1 C T 14: 31,279,171 G2406S probably benign Het
Dnah8 A G 17: 30,737,427 K2127R probably damaging Het
Dusp13 G A 14: 21,740,165 R38C probably benign Het
Ebf2 T A 14: 67,235,145 I4N probably benign Het
Fcgbp A G 7: 28,091,483 N723S possibly damaging Het
Galnt15 T A 14: 32,048,070 V368E probably damaging Het
Garem2 A G 5: 30,108,264 E42G possibly damaging Het
Gcc1 C T 6: 28,418,183 S717N probably damaging Het
Gfm2 T C 13: 97,172,693 probably null Het
Gm49333 C T 16: 20,640,625 P570L probably damaging Het
Gpr1 T C 1: 63,183,986 E30G probably benign Het
Helb T C 10: 120,084,885 D1051G possibly damaging Het
Helz2 T A 2: 181,232,468 I2078F possibly damaging Het
Hsph1 A T 5: 149,629,805 V297D probably damaging Het
Ifnar1 A G 16: 91,505,191 Y518C probably benign Het
Kcnip2 T A 19: 45,794,771 D153V probably damaging Het
Kif15 A T 9: 123,017,427 probably benign Het
Kif21b T C 1: 136,145,304 F147L probably damaging Het
Klhl29 T C 12: 5,090,537 R702G probably damaging Het
Lemd3 C T 10: 120,931,973 E667K possibly damaging Het
Loxl3 T C 6: 83,035,522 L14P probably damaging Het
Lrrd1 A T 5: 3,850,963 K423* probably null Het
Mia2 A G 12: 59,108,800 D433G probably damaging Het
Mpp2 G T 11: 102,063,273 A216E probably benign Het
Mro T C 18: 73,876,840 probably null Het
Mybpc1 T G 10: 88,523,044 Y1081S probably damaging Het
Myh8 T G 11: 67,299,315 S1260R possibly damaging Het
Myo3b T C 2: 70,251,750 V618A probably damaging Het
Naip2 T G 13: 100,178,268 D334A possibly damaging Het
Naip5 T A 13: 100,219,830 E1092D probably benign Het
Nlrp4c T C 7: 6,104,609 *983Q probably null Het
Nlrp9a T G 7: 26,558,273 F439V probably damaging Het
Nploc4 A T 11: 120,428,542 L64H probably damaging Het
Ola1 T C 2: 73,093,716 E246G probably benign Het
Otof G A 5: 30,380,188 S1259F probably benign Het
Pde4dip T C 3: 97,692,359 T2438A probably damaging Het
Pex1 A G 5: 3,636,844 T1242A probably damaging Het
Pink1 A T 4: 138,315,745 probably benign Het
Prkcq A G 2: 11,247,008 T219A probably damaging Het
Ptcd3 A T 6: 71,903,474 Y88* probably null Het
Ptpru A G 4: 131,788,380 Y888H probably damaging Het
Rapgef6 A G 11: 54,687,841 N1063S probably benign Het
Slc1a4 G A 11: 20,332,532 probably benign Het
Slc4a4 T C 5: 89,057,709 probably benign Het
Slc6a18 A T 13: 73,671,703 N249K possibly damaging Het
Slco2b1 T G 7: 99,689,007 I104L probably damaging Het
Syne3 A T 12: 104,939,612 S897R probably benign Het
Tcrg-V4 C T 13: 19,184,999 Q7* probably null Het
Tmem136 C T 9: 43,111,369 R230Q probably benign Het
Tnni3k A G 3: 155,038,509 S69P probably damaging Het
Tnpo2 A G 8: 85,053,534 K700E probably benign Het
Top3a T C 11: 60,745,869 K657E probably damaging Het
Trim6 T C 7: 104,225,952 L132P probably damaging Het
Tshz1 T C 18: 84,014,862 T474A probably benign Het
Unc13d AATGCCTCCCATGCC AATGCCTCCCATGCCTCCCATGCC 11: 116,068,172 probably benign Het
Vmn1r179 A T 7: 23,928,809 I142L probably benign Het
Zbtb2 A T 10: 4,369,183 F281Y probably damaging Het
Zfp318 T C 17: 46,412,507 V1812A probably benign Het
Other mutations in Abcc2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00430:Abcc2 APN 19 43784202 missense probably benign 0.39
IGL01611:Abcc2 APN 19 43826629 missense probably damaging 1.00
IGL01800:Abcc2 APN 19 43784295 missense possibly damaging 0.78
IGL02008:Abcc2 APN 19 43821750 splice site probably benign
IGL02041:Abcc2 APN 19 43784235 missense probably damaging 1.00
IGL02528:Abcc2 APN 19 43798504 missense probably benign
IGL02950:Abcc2 APN 19 43825967 missense possibly damaging 0.83
IGL03081:Abcc2 APN 19 43782402 utr 5 prime probably benign
IGL03397:Abcc2 APN 19 43784304 missense probably benign 0.00
loser UTSW 19 43839411 utr 3 prime probably benign
nelson UTSW 19 43803739 missense probably benign 0.07
Sore UTSW 19 43798194 missense probably benign 0.22
BB002:Abcc2 UTSW 19 43807112 missense probably benign 0.07
BB012:Abcc2 UTSW 19 43807112 missense probably benign 0.07
PIT4453001:Abcc2 UTSW 19 43803782 nonsense probably null
PIT4519001:Abcc2 UTSW 19 43819397 missense possibly damaging 0.81
R0197:Abcc2 UTSW 19 43826614 nonsense probably null
R0326:Abcc2 UTSW 19 43825947 missense possibly damaging 0.90
R0391:Abcc2 UTSW 19 43821605 splice site probably benign
R0558:Abcc2 UTSW 19 43800724 missense probably benign 0.00
R0577:Abcc2 UTSW 19 43819401 missense probably damaging 1.00
R0787:Abcc2 UTSW 19 43798516 critical splice donor site probably null
R1189:Abcc2 UTSW 19 43819413 missense probably damaging 1.00
R1200:Abcc2 UTSW 19 43833987 missense probably damaging 0.98
R1395:Abcc2 UTSW 19 43833940 missense probably benign 0.22
R1606:Abcc2 UTSW 19 43836652 missense probably damaging 1.00
R1775:Abcc2 UTSW 19 43798419 missense possibly damaging 0.88
R1797:Abcc2 UTSW 19 43814786 missense possibly damaging 0.81
R1797:Abcc2 UTSW 19 43833987 missense probably damaging 0.98
R1826:Abcc2 UTSW 19 43822014 missense probably benign 0.01
R1882:Abcc2 UTSW 19 43798506 missense probably benign 0.00
R1913:Abcc2 UTSW 19 43807244 missense probably benign 0.10
R1986:Abcc2 UTSW 19 43829879 missense probably damaging 1.00
R1991:Abcc2 UTSW 19 43807142 missense probably damaging 1.00
R1992:Abcc2 UTSW 19 43807142 missense probably damaging 1.00
R2006:Abcc2 UTSW 19 43805061 missense probably damaging 1.00
R2057:Abcc2 UTSW 19 43818038 missense probably damaging 1.00
R3709:Abcc2 UTSW 19 43798446 missense possibly damaging 0.80
R3802:Abcc2 UTSW 19 43821626 missense probably benign 0.01
R4010:Abcc2 UTSW 19 43829864 missense possibly damaging 0.75
R4014:Abcc2 UTSW 19 43823120 missense probably benign
R4064:Abcc2 UTSW 19 43804993 nonsense probably null
R4296:Abcc2 UTSW 19 43823074 missense probably damaging 1.00
R4296:Abcc2 UTSW 19 43823075 missense probably damaging 1.00
R4363:Abcc2 UTSW 19 43799136 missense possibly damaging 0.94
R4580:Abcc2 UTSW 19 43811119 missense probably damaging 1.00
R4625:Abcc2 UTSW 19 43803739 missense probably benign 0.07
R4631:Abcc2 UTSW 19 43814707 missense possibly damaging 0.70
R4671:Abcc2 UTSW 19 43800718 missense probably benign
R4715:Abcc2 UTSW 19 43816882 missense possibly damaging 0.54
R4726:Abcc2 UTSW 19 43832114 missense probably benign 0.23
R4760:Abcc2 UTSW 19 43810481 missense probably benign 0.03
R4801:Abcc2 UTSW 19 43819361 missense probably damaging 1.00
R4802:Abcc2 UTSW 19 43819361 missense probably damaging 1.00
R4976:Abcc2 UTSW 19 43800635 missense probably benign 0.34
R5143:Abcc2 UTSW 19 43821661 missense probably benign 0.28
R5206:Abcc2 UTSW 19 43818150 missense probably damaging 1.00
R5376:Abcc2 UTSW 19 43829900 missense possibly damaging 0.76
R5478:Abcc2 UTSW 19 43839465 utr 3 prime probably benign
R5700:Abcc2 UTSW 19 43798194 missense probably benign 0.22
R5863:Abcc2 UTSW 19 43798136 missense probably benign 0.00
R5928:Abcc2 UTSW 19 43819358 missense probably damaging 1.00
R5955:Abcc2 UTSW 19 43813190 missense probably damaging 0.98
R5983:Abcc2 UTSW 19 43819503 missense probably benign
R6014:Abcc2 UTSW 19 43826735 missense probably benign
R6419:Abcc2 UTSW 19 43837508 splice site probably null
R6497:Abcc2 UTSW 19 43805105 missense probably damaging 1.00
R6510:Abcc2 UTSW 19 43782206 splice site probably null
R6614:Abcc2 UTSW 19 43819361 missense probably benign 0.01
R6649:Abcc2 UTSW 19 43812502 missense probably benign 0.05
R6653:Abcc2 UTSW 19 43812502 missense probably benign 0.05
R6670:Abcc2 UTSW 19 43839411 utr 3 prime probably benign
R6964:Abcc2 UTSW 19 43798076 missense probably benign 0.12
R6989:Abcc2 UTSW 19 43832172 missense probably damaging 1.00
R7015:Abcc2 UTSW 19 43798178 missense probably benign 0.03
R7026:Abcc2 UTSW 19 43816953 missense probably benign 0.00
R7026:Abcc2 UTSW 19 43830535 missense probably benign 0.01
R7136:Abcc2 UTSW 19 43837460 missense probably damaging 1.00
R7252:Abcc2 UTSW 19 43827949 missense probably damaging 0.98
R7293:Abcc2 UTSW 19 43807053 missense probably damaging 1.00
R7392:Abcc2 UTSW 19 43808687 missense probably damaging 0.97
R7450:Abcc2 UTSW 19 43822039 missense probably damaging 1.00
R7654:Abcc2 UTSW 19 43826593 missense possibly damaging 0.87
R7787:Abcc2 UTSW 19 43784246 missense probably damaging 1.00
R7815:Abcc2 UTSW 19 43830427 missense probably benign 0.01
R7911:Abcc2 UTSW 19 43803670 missense probably benign 0.00
R7919:Abcc2 UTSW 19 43816809 missense probably damaging 1.00
R7925:Abcc2 UTSW 19 43807112 missense probably benign 0.07
R7993:Abcc2 UTSW 19 43814792 missense possibly damaging 0.71
R8097:Abcc2 UTSW 19 43816955 missense probably benign 0.10
R8177:Abcc2 UTSW 19 43807080 missense probably damaging 1.00
R8492:Abcc2 UTSW 19 43804971 missense probably benign 0.07
R8693:Abcc2 UTSW 19 43822035 missense probably benign 0.06
R8722:Abcc2 UTSW 19 43836613 missense possibly damaging 0.89
R8734:Abcc2 UTSW 19 43782416 missense probably damaging 1.00
R8774:Abcc2 UTSW 19 43799138 missense probably damaging 0.99
R8774-TAIL:Abcc2 UTSW 19 43799138 missense probably damaging 0.99
R8798:Abcc2 UTSW 19 43808666 missense probably benign 0.01
R8889:Abcc2 UTSW 19 43807132 missense possibly damaging 0.88
R8892:Abcc2 UTSW 19 43807132 missense possibly damaging 0.88
R8936:Abcc2 UTSW 19 43808662 missense probably benign 0.35
R9116:Abcc2 UTSW 19 43804952 missense probably benign 0.30
R9201:Abcc2 UTSW 19 43798441 missense probably damaging 0.97
R9246:Abcc2 UTSW 19 43798443 missense probably benign 0.01
R9345:Abcc2 UTSW 19 43819430 missense probably damaging 0.97
R9487:Abcc2 UTSW 19 43818032 missense probably damaging 1.00
X0025:Abcc2 UTSW 19 43832205 critical splice donor site probably null
Z1177:Abcc2 UTSW 19 43803734 missense probably benign 0.05
Z1177:Abcc2 UTSW 19 43803736 missense probably benign 0.00
Z1177:Abcc2 UTSW 19 43823100 nonsense probably null
Predicted Primers
Posted On 2021-11-19