Incidental Mutation 'R8889:Abcc2'
ID 677602
Institutional Source Beutler Lab
Gene Symbol Abcc2
Ensembl Gene ENSMUSG00000025194
Gene Name ATP-binding cassette, sub-family C (CFTR/MRP), member 2
Synonyms multidrug resistance protein 2, Cmoat, Mrp2
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R8889 (G1)
Quality Score 225.009
Status Validated
Chromosome 19
Chromosomal Location 43782192-43840740 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to G at 43807132 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Serine to Arginine at position 442 (S442R)
Ref Sequence ENSEMBL: ENSMUSP00000026208 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026208]
AlphaFold Q8VI47
Predicted Effect possibly damaging
Transcript: ENSMUST00000026208
AA Change: S442R

PolyPhen 2 Score 0.878 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000026208
Gene: ENSMUSG00000025194
AA Change: S442R

DomainStartEndE-ValueType
transmembrane domain 29 51 N/A INTRINSIC
transmembrane domain 63 85 N/A INTRINSIC
transmembrane domain 100 116 N/A INTRINSIC
transmembrane domain 128 150 N/A INTRINSIC
transmembrane domain 160 182 N/A INTRINSIC
Pfam:ABC_membrane 319 591 3.4e-37 PFAM
low complexity region 597 608 N/A INTRINSIC
AAA 661 836 1.77e-8 SMART
low complexity region 906 933 N/A INTRINSIC
Pfam:ABC_membrane 977 1249 5.4e-48 PFAM
AAA 1324 1509 1.33e-12 SMART
Meta Mutation Damage Score 0.4019 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 100% (78/78)
MGI Phenotype FUNCTION: The membrane-associated protein encoded by this gene is a member of the superfamily of ATP-binding cassette (ABC) transporters. ABC proteins transport various molecules across extra- and intra-cellular membranes. ABC genes are divided into seven distinct subfamilies (ABC1, MDR/TAP, MRP, ALD, OABP, GCN20, White). This protein is a member of the MRP subfamily which is involved in multi-drug resistance. This protein functions in the canalicular surface of the hepatocyte and in biliary transport, and appears to contribute to drug resistance in mammalian cells. Several different mutations in the human gene have been observed in patients with Dubin-Johnson syndrome (DJS), an autosomal recessive disorder characterized by conjugated hyperbilirubinemia. Alternative splice variants have been observed for this gene; however, they have not been fully described. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for disruptions in this gene have moderately enlarged livers, elevated plasma and urine bilirubin, and a reduced ability to clear various drugs and carcinogens from the blood. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 78 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9230110F15Rik T A 9: 35,839,386 T47S probably damaging Het
Abca14 T A 7: 120,216,383 L285I probably damaging Het
Adgrl3 A T 5: 81,726,669 I938F probably damaging Het
Ank1 T C 8: 23,116,974 L1297P probably damaging Het
Ap3b1 G A 13: 94,542,840 V997M unknown Het
Ash2l T C 8: 25,823,219 K413R probably benign Het
Cacnb1 A T 11: 98,010,366 V220E probably damaging Het
Cacul1 A T 19: 60,580,522 L66Q probably damaging Het
Camkv C T 9: 107,946,134 R120* probably null Het
Ccny T G 18: 9,345,235 S180R probably damaging Het
Cdh23 G T 10: 60,307,505 H3012Q probably damaging Het
Clasp2 T A 9: 113,880,183 L680Q probably damaging Het
Clip1 A T 5: 123,579,502 S1241R probably benign Het
Cthrc1 T A 15: 39,077,050 L16H probably damaging Het
Ctnna1 G A 18: 35,239,533 V514I possibly damaging Het
Ddr1 A C 17: 35,682,664 I852S probably benign Het
Echs1 A C 7: 140,108,118 L258R probably damaging Het
Epha8 G T 4: 136,934,539 H582N probably benign Het
Exph5 G T 9: 53,376,655 G1679W probably damaging Het
Fhod3 G A 18: 25,056,395 probably null Het
Gm10803 G A 2: 93,563,936 D18N unknown Het
Gpr152 T A 19: 4,142,724 I88N probably damaging Het
Gpr179 T C 11: 97,335,764 D1855G possibly damaging Het
H2al2a T A 2: 17,996,788 D29V probably damaging Het
Hnrnpf T G 6: 117,924,792 S346A probably benign Het
Hsd11b2 C T 8: 105,522,631 R213C probably damaging Het
Il17rd A G 14: 27,099,973 D552G possibly damaging Het
Ipo9 T C 1: 135,386,806 N904S possibly damaging Het
Klhl14 T G 18: 21,558,163 T437P possibly damaging Het
Krt5 T C 15: 101,710,750 M268V probably benign Het
Lhx4 T C 1: 155,705,267 T171A possibly damaging Het
Ltn1 A T 16: 87,432,342 probably benign Het
Macf1 A G 4: 123,355,243 L7165P probably damaging Het
Micall2 T A 5: 139,717,499 H194L probably damaging Het
Mmp16 T A 4: 18,051,820 Y270N probably damaging Het
Nme6 T G 9: 109,839,638 F41V probably damaging Het
Npffr1 A G 10: 61,614,160 N71S possibly damaging Het
Olfr1287 A G 2: 111,449,622 I161V probably benign Het
Olfr409-ps1 T C 11: 74,317,123 W33R probably damaging Het
Pard3b T A 1: 62,637,867 Y1186N probably damaging Het
Pcca A G 14: 122,557,711 probably benign Het
Plekha8 A G 6: 54,615,555 probably benign Het
Ptpn14 T A 1: 189,822,675 L144* probably null Het
Rad52 C T 6: 119,913,080 R56C probably damaging Het
Rdx C T 9: 52,086,453 R576C probably damaging Het
Rnf135 C T 11: 80,184,131 T72I probably benign Het
Robo4 G T 9: 37,403,305 R196L probably benign Het
Rsf1 G GACGTCGGCT 7: 97,579,909 probably benign Het
Rsf1 A T 7: 97,678,964 I1058F Het
Ryr2 A T 13: 11,785,104 V919E probably damaging Het
Slc39a6 A T 18: 24,596,329 Y442* probably null Het
Slc4a11 T G 2: 130,687,220 S437R probably damaging Het
Slc7a6 T A 8: 106,195,902 V440E probably damaging Het
Sox2 A T 3: 34,650,980 N189Y possibly damaging Het
Spata13 A T 14: 60,756,581 M1161L probably benign Het
Spock3 T A 8: 62,951,952 Y51* probably null Het
Sptbn1 A G 11: 30,117,800 Y1805H probably benign Het
Tcerg1l C T 7: 138,397,531 W41* probably null Het
Tdrd9 A G 12: 112,013,284 Y401C probably benign Het
Tex47 A T 5: 7,305,115 I99F probably damaging Het
Tlr9 G A 9: 106,222,635 probably benign Het
Tmem209 T A 6: 30,497,943 S276C possibly damaging Het
Tmprss11f A C 5: 86,539,759 S97A possibly damaging Het
Tnfaip8 ACACACTC AC 18: 50,046,841 probably benign Het
Ttc7 T A 17: 87,330,092 M425K probably damaging Het
Ttn C T 2: 76,909,122 G3737D unknown Het
Unc13b A T 4: 43,176,484 R2437S unknown Het
Uqcrc1 C T 9: 108,937,118 R58C probably damaging Het
Vmn1r128 A G 7: 21,349,815 Y148C possibly damaging Het
Vmn1r193 T C 13: 22,219,669 Y51C probably benign Het
Vmn2r112 A G 17: 22,618,631 Y691C probably damaging Het
Vmn2r25 T A 6: 123,823,610 D591V probably damaging Het
Vmn2r94 A G 17: 18,244,073 S652P possibly damaging Het
Vps50 T A 6: 3,536,967 C313S probably damaging Het
Vwa5b1 A G 4: 138,610,730 V93A probably benign Het
Xrcc5 T G 1: 72,343,031 D455E possibly damaging Het
Zdhhc6 T A 19: 55,302,555 probably benign Het
Zfp964 G A 8: 69,663,755 G335D probably damaging Het
Other mutations in Abcc2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00430:Abcc2 APN 19 43784202 missense probably benign 0.39
IGL01611:Abcc2 APN 19 43826629 missense probably damaging 1.00
IGL01800:Abcc2 APN 19 43784295 missense possibly damaging 0.78
IGL02008:Abcc2 APN 19 43821750 splice site probably benign
IGL02041:Abcc2 APN 19 43784235 missense probably damaging 1.00
IGL02528:Abcc2 APN 19 43798504 missense probably benign
IGL02950:Abcc2 APN 19 43825967 missense possibly damaging 0.83
IGL03081:Abcc2 APN 19 43782402 utr 5 prime probably benign
IGL03397:Abcc2 APN 19 43784304 missense probably benign 0.00
loser UTSW 19 43839411 utr 3 prime probably benign
nelson UTSW 19 43803739 missense probably benign 0.07
Sore UTSW 19 43798194 missense probably benign 0.22
BB002:Abcc2 UTSW 19 43807112 missense probably benign 0.07
BB012:Abcc2 UTSW 19 43807112 missense probably benign 0.07
PIT4453001:Abcc2 UTSW 19 43803782 nonsense probably null
PIT4519001:Abcc2 UTSW 19 43819397 missense possibly damaging 0.81
R0197:Abcc2 UTSW 19 43826614 nonsense probably null
R0326:Abcc2 UTSW 19 43825947 missense possibly damaging 0.90
R0391:Abcc2 UTSW 19 43821605 splice site probably benign
R0558:Abcc2 UTSW 19 43800724 missense probably benign 0.00
R0577:Abcc2 UTSW 19 43819401 missense probably damaging 1.00
R0787:Abcc2 UTSW 19 43798516 critical splice donor site probably null
R1189:Abcc2 UTSW 19 43819413 missense probably damaging 1.00
R1200:Abcc2 UTSW 19 43833987 missense probably damaging 0.98
R1395:Abcc2 UTSW 19 43833940 missense probably benign 0.22
R1606:Abcc2 UTSW 19 43836652 missense probably damaging 1.00
R1775:Abcc2 UTSW 19 43798419 missense possibly damaging 0.88
R1797:Abcc2 UTSW 19 43814786 missense possibly damaging 0.81
R1797:Abcc2 UTSW 19 43833987 missense probably damaging 0.98
R1826:Abcc2 UTSW 19 43822014 missense probably benign 0.01
R1882:Abcc2 UTSW 19 43798506 missense probably benign 0.00
R1913:Abcc2 UTSW 19 43807244 missense probably benign 0.10
R1986:Abcc2 UTSW 19 43829879 missense probably damaging 1.00
R1991:Abcc2 UTSW 19 43807142 missense probably damaging 1.00
R1992:Abcc2 UTSW 19 43807142 missense probably damaging 1.00
R2006:Abcc2 UTSW 19 43805061 missense probably damaging 1.00
R2057:Abcc2 UTSW 19 43818038 missense probably damaging 1.00
R3709:Abcc2 UTSW 19 43798446 missense possibly damaging 0.80
R3802:Abcc2 UTSW 19 43821626 missense probably benign 0.01
R4010:Abcc2 UTSW 19 43829864 missense possibly damaging 0.75
R4014:Abcc2 UTSW 19 43823120 missense probably benign
R4064:Abcc2 UTSW 19 43804993 nonsense probably null
R4296:Abcc2 UTSW 19 43823074 missense probably damaging 1.00
R4296:Abcc2 UTSW 19 43823075 missense probably damaging 1.00
R4363:Abcc2 UTSW 19 43799136 missense possibly damaging 0.94
R4580:Abcc2 UTSW 19 43811119 missense probably damaging 1.00
R4625:Abcc2 UTSW 19 43803739 missense probably benign 0.07
R4631:Abcc2 UTSW 19 43814707 missense possibly damaging 0.70
R4671:Abcc2 UTSW 19 43800718 missense probably benign
R4715:Abcc2 UTSW 19 43816882 missense possibly damaging 0.54
R4726:Abcc2 UTSW 19 43832114 missense probably benign 0.23
R4760:Abcc2 UTSW 19 43810481 missense probably benign 0.03
R4801:Abcc2 UTSW 19 43819361 missense probably damaging 1.00
R4802:Abcc2 UTSW 19 43819361 missense probably damaging 1.00
R4976:Abcc2 UTSW 19 43800635 missense probably benign 0.34
R5143:Abcc2 UTSW 19 43821661 missense probably benign 0.28
R5206:Abcc2 UTSW 19 43818150 missense probably damaging 1.00
R5376:Abcc2 UTSW 19 43829900 missense possibly damaging 0.76
R5478:Abcc2 UTSW 19 43839465 utr 3 prime probably benign
R5700:Abcc2 UTSW 19 43798194 missense probably benign 0.22
R5863:Abcc2 UTSW 19 43798136 missense probably benign 0.00
R5928:Abcc2 UTSW 19 43819358 missense probably damaging 1.00
R5955:Abcc2 UTSW 19 43813190 missense probably damaging 0.98
R5983:Abcc2 UTSW 19 43819503 missense probably benign
R6014:Abcc2 UTSW 19 43826735 missense probably benign
R6419:Abcc2 UTSW 19 43837508 splice site probably null
R6497:Abcc2 UTSW 19 43805105 missense probably damaging 1.00
R6510:Abcc2 UTSW 19 43782206 splice site probably null
R6614:Abcc2 UTSW 19 43819361 missense probably benign 0.01
R6649:Abcc2 UTSW 19 43812502 missense probably benign 0.05
R6653:Abcc2 UTSW 19 43812502 missense probably benign 0.05
R6670:Abcc2 UTSW 19 43839411 utr 3 prime probably benign
R6964:Abcc2 UTSW 19 43798076 missense probably benign 0.12
R6989:Abcc2 UTSW 19 43832172 missense probably damaging 1.00
R7015:Abcc2 UTSW 19 43798178 missense probably benign 0.03
R7026:Abcc2 UTSW 19 43816953 missense probably benign 0.00
R7026:Abcc2 UTSW 19 43830535 missense probably benign 0.01
R7136:Abcc2 UTSW 19 43837460 missense probably damaging 1.00
R7252:Abcc2 UTSW 19 43827949 missense probably damaging 0.98
R7293:Abcc2 UTSW 19 43807053 missense probably damaging 1.00
R7392:Abcc2 UTSW 19 43808687 missense probably damaging 0.97
R7450:Abcc2 UTSW 19 43822039 missense probably damaging 1.00
R7654:Abcc2 UTSW 19 43826593 missense possibly damaging 0.87
R7787:Abcc2 UTSW 19 43784246 missense probably damaging 1.00
R7815:Abcc2 UTSW 19 43830427 missense probably benign 0.01
R7911:Abcc2 UTSW 19 43803670 missense probably benign 0.00
R7919:Abcc2 UTSW 19 43816809 missense probably damaging 1.00
R7925:Abcc2 UTSW 19 43807112 missense probably benign 0.07
R7993:Abcc2 UTSW 19 43814792 missense possibly damaging 0.71
R8097:Abcc2 UTSW 19 43816955 missense probably benign 0.10
R8177:Abcc2 UTSW 19 43807080 missense probably damaging 1.00
R8492:Abcc2 UTSW 19 43804971 missense probably benign 0.07
R8693:Abcc2 UTSW 19 43822035 missense probably benign 0.06
R8722:Abcc2 UTSW 19 43836613 missense possibly damaging 0.89
R8734:Abcc2 UTSW 19 43782416 missense probably damaging 1.00
R8774:Abcc2 UTSW 19 43799138 missense probably damaging 0.99
R8774-TAIL:Abcc2 UTSW 19 43799138 missense probably damaging 0.99
R8798:Abcc2 UTSW 19 43808666 missense probably benign 0.01
R8892:Abcc2 UTSW 19 43807132 missense possibly damaging 0.88
R8936:Abcc2 UTSW 19 43808662 missense probably benign 0.35
R9031:Abcc2 UTSW 19 43822027 missense probably benign
R9116:Abcc2 UTSW 19 43804952 missense probably benign 0.30
R9201:Abcc2 UTSW 19 43798441 missense probably damaging 0.97
R9246:Abcc2 UTSW 19 43798443 missense probably benign 0.01
R9345:Abcc2 UTSW 19 43819430 missense probably damaging 0.97
R9487:Abcc2 UTSW 19 43818032 missense probably damaging 1.00
X0025:Abcc2 UTSW 19 43832205 critical splice donor site probably null
Z1177:Abcc2 UTSW 19 43803734 missense probably benign 0.05
Z1177:Abcc2 UTSW 19 43803736 missense probably benign 0.00
Z1177:Abcc2 UTSW 19 43823100 nonsense probably null
Predicted Primers PCR Primer
(F):5'- TGTATATGGAACCCACCTTTGTG -3'
(R):5'- GTCAAAAGAGACATGCGCAC -3'

Sequencing Primer
(F):5'- GAACCCACCTTTGTGTTGTG -3'
(R):5'- GACATGCGCACAGGTGATTCTTC -3'
Posted On 2021-08-02