Mutagenetix > Incidental Mutation

Incidental Mutation 'R9094:Cacna1e'

691186

Institutional Source

Beutler Lab

Gene Symbol

Cacna1e

Ensembl Gene

ENSMUSG00000004110

Gene Name

calcium channel, voltage-dependent, R type, alpha 1E subunit

Synonyms

Cav2.3, Cchra1, alpha1E

MMRRC Submission

068909-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.166) question?

Stock #

R9094 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

154266477-154760247 bp(-) (GRCm39)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 154355064 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Tyrosine to Phenylalanine at position 693 (Y693F)

Ref Sequence

ENSEMBL: ENSMUSP00000140937 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000004214] [ENSMUST00000187541] [ENSMUST00000211821]

AlphaFold

no structure available at present

Predicted Effect

probably damaging
Transcript: ENSMUST00000004214
AA Change: Y385F

PolyPhen 2 Score 0.971 (Sensitivity: 0.77; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000004214
Gene: ENSMUSG00000004110
AA Change: Y385F

Domain	Start	End	E-Value	Type
Pfam:Ion_trans	1	55	6.7e-10	PFAM
Pfam:Ion_trans	168	407	3.3e-56	PFAM
Pfam:PKD_channel	257	401	3.3e-7	PFAM
low complexity region	409	414	N/A	INTRINSIC
low complexity region	455	469	N/A	INTRINSIC
low complexity region	496	514	N/A	INTRINSIC
low complexity region	604	620	N/A	INTRINSIC
low complexity region	626	640	N/A	INTRINSIC
coiled coil region	793	823	N/A	INTRINSIC
Pfam:Ion_trans	847	1128	2.3e-63	PFAM
Pfam:Ion_trans	1172	1429	2.6e-65	PFAM
Pfam:PKD_channel	1256	1424	2.8e-10	PFAM
Pfam:GPHH	1431	1500	1.3e-37	PFAM
Ca_chan_IQ	1555	1589	5.93e-13	SMART
low complexity region	1701	1717	N/A	INTRINSIC
low complexity region	1729	1742	N/A	INTRINSIC
low complexity region	1764	1780	N/A	INTRINSIC
low complexity region	1789	1804	N/A	INTRINSIC
low complexity region	1808	1822	N/A	INTRINSIC
low complexity region	1832	1846	N/A	INTRINSIC
low complexity region	1867	1878	N/A	INTRINSIC
low complexity region	1936	1946	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000187541
AA Change: Y693F

PolyPhen 2 Score 0.928 (Sensitivity: 0.81; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000140937
Gene: ENSMUSG00000004110
AA Change: Y693F

Domain	Start	End	E-Value	Type
Pfam:Ion_trans	128	351	8.5e-54	PFAM
PDB:4DEX\|B	354	462	6e-36	PDB
Pfam:Ion_trans	511	703	2.2e-46	PFAM
Pfam:PKD_channel	565	710	1.4e-6	PFAM
low complexity region	717	722	N/A	INTRINSIC
low complexity region	763	777	N/A	INTRINSIC
low complexity region	804	822	N/A	INTRINSIC
low complexity region	912	928	N/A	INTRINSIC
low complexity region	934	948	N/A	INTRINSIC
coiled coil region	1101	1131	N/A	INTRINSIC
low complexity region	1162	1175	N/A	INTRINSIC
Pfam:Ion_trans	1191	1425	4.3e-55	PFAM
Pfam:Ion_trans	1515	1725	5.3e-60	PFAM
Pfam:PKD_channel	1565	1732	4.7e-10	PFAM
Ca_chan_IQ	1863	1897	5.93e-13	SMART
low complexity region	2009	2025	N/A	INTRINSIC
low complexity region	2037	2050	N/A	INTRINSIC
low complexity region	2072	2088	N/A	INTRINSIC
low complexity region	2097	2112	N/A	INTRINSIC
low complexity region	2116	2130	N/A	INTRINSIC
low complexity region	2140	2154	N/A	INTRINSIC
low complexity region	2175	2186	N/A	INTRINSIC
low complexity region	2244	2254	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000211821
AA Change: Y631F

PolyPhen 2 Score 0.963 (Sensitivity: 0.78; Specificity: 0.95)

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.7%
20x: 99.2%

Validation Efficiency

96% (67/70)

MGI Phenotype

FUNCTION: This gene encodes an integral membrane protein that belongs to the calcium channel alpha-1 subunits family. Voltage-sensitive calcium channels mediate the entry of calcium ions into excitable cells and are also involved in a variety of calcium-dependent processes. Voltage-dependent calcium channels are multi-subunit complexes, comprised of alpha-1, alpha-2, beta and delta subunits in a 1:1:1:1 ratio. The isoform alpha-1E gives rise to R-type calcium currents and belongs to the high-voltage activated group. Calcium channels containing the alpha-1E subunit may be involved in the modulation of neuronal firing patterns, an important component of information processing. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for targeted null mutations exhibit altered R-type Ca2+ channels, increased timidity and body weight, impaired glucose tolerance, reduced locomotor activity, and lack of the cocaine stimulation of locomotor response. [provided by MGI curators]

Allele List at MGI

All alleles(7) : Targeted, knock-out(3) Targeted, other(3) Gene trapped(1)

Other mutations in this stock

Total: 65 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
3110021N24Rik	T	C	4: 108,637,744 (GRCm39)	V37A	unknown	Het
3425401B19Rik	G	A	14: 32,382,614 (GRCm39)	S1117L	possibly damaging	Het
Abi3bp	A	G	16: 56,456,590 (GRCm39)	I1021V	probably benign	Het
Agrn	C	A	4: 156,253,264 (GRCm39)	K1848N	probably benign	Het
Anln	A	G	9: 22,249,283 (GRCm39)	V1005A	probably benign	Het
Arb2a	A	G	13: 78,311,725 (GRCm39)	K356R	possibly damaging	Het
Arid3b	A	G	9: 57,741,327 (GRCm39)	Y40H	probably damaging	Het
Bco1	A	C	8: 117,859,917 (GRCm39)	D540A	probably benign	Het
Blnk	A	G	19: 40,982,482 (GRCm39)	I7T	probably benign	Het
Brca2	T	G	5: 150,475,770 (GRCm39)	D2493E	probably benign	Het
Bsn	T	A	9: 107,988,052 (GRCm39)	M2567L	unknown	Het
Catsperg1	G	C	7: 28,884,152 (GRCm39)	T987R	probably damaging	Het
Cpa4	G	T	6: 30,574,393 (GRCm39)	D61Y	possibly damaging	Het
Cpne1	A	C	2: 155,921,080 (GRCm39)	V70G	probably damaging	Het
Dnase1l3	A	T	14: 7,987,306 (GRCm38)	N81K	probably damaging	Het
Duxf3	GCCC	GCC	10: 58,066,944 (GRCm39)		probably null	Het
Fbxo31	G	A	8: 122,281,136 (GRCm39)	R337C	probably damaging	Het
Fbxo34	C	G	14: 47,767,928 (GRCm39)	H480Q	probably benign	Het
Frmd4b	T	C	6: 97,398,559 (GRCm39)	E96G		Het
Gdpgp1	T	A	7: 79,888,216 (GRCm39)	D82E	probably benign	Het
Gjb3	GCCAGATGCGCCCA	GCCAGATGCGCCCAGATGCGCCCA	4: 127,220,458 (GRCm39)		probably null	Het
Grpel1	A	G	5: 36,626,823 (GRCm39)	N35S	probably benign	Het
Il12rb1	A	G	8: 71,273,291 (GRCm39)	T665A	possibly damaging	Het
Il16	T	C	7: 83,301,559 (GRCm39)	T886A	probably benign	Het
Insig1	T	A	5: 28,278,570 (GRCm39)	C128*	probably null	Het
Kcnk10	T	A	12: 98,484,775 (GRCm39)	E120D	probably benign	Het
Kctd1	T	C	18: 15,195,369 (GRCm39)	N418S	possibly damaging	Het
Kifbp	A	G	10: 62,395,037 (GRCm39)	V535A	probably damaging	Het
Klhl20	T	A	1: 160,933,055 (GRCm39)	H251L	probably damaging	Het
Ldlrad3	T	C	2: 101,888,326 (GRCm39)	D127G	probably damaging	Het
Lrp3	T	C	7: 34,903,182 (GRCm39)	Y388C	probably damaging	Het
Lrrc4	G	A	6: 28,830,206 (GRCm39)	R47W	possibly damaging	Het
Luzp1	A	T	4: 136,272,562 (GRCm39)	D1022V	probably damaging	Het
Mllt1	C	A	17: 57,212,737 (GRCm39)	R132L	probably damaging	Het
Ncoa1	G	T	12: 4,345,494 (GRCm39)	H618N	possibly damaging	Het
Nelfcd	T	C	2: 174,265,861 (GRCm39)	S318P	probably damaging	Het
Ngly1	A	C	14: 16,280,721 (GRCm38)	T301P	probably damaging	Het
Npy5r	G	A	8: 67,133,560 (GRCm39)	T411I	probably damaging	Het
Or55b10	T	C	7: 102,143,568 (GRCm39)	E138G	possibly damaging	Het
Or5d46	A	G	2: 88,170,248 (GRCm39)	N113S	probably benign	Het
Pcdha6	T	A	18: 37,101,593 (GRCm39)	I262N	probably damaging	Het
Peg10	GAT	GATCAT	6: 4,756,449 (GRCm39)		probably benign	Het
Pm20d1	C	A	1: 131,730,481 (GRCm39)	A245D	possibly damaging	Het
Rars1	T	C	11: 35,718,182 (GRCm39)		probably benign	Het
Rbms2	T	A	10: 127,987,107 (GRCm39)	I62F	probably damaging	Het
Rev3l	A	T	10: 39,700,809 (GRCm39)	T1769S	probably benign	Het
Rexo1	A	G	10: 80,378,854 (GRCm39)	Y1061H	probably damaging	Het
Rgs3	A	T	4: 62,500,240 (GRCm39)	I26F	probably damaging	Het
Rsf1	G	GACGGCGGCC	7: 97,229,116 (GRCm39)		probably benign	Het
Rtkn	A	T	6: 83,128,018 (GRCm39)	N406Y	possibly damaging	Het
Rtn4r	A	T	16: 17,969,708 (GRCm39)	I379F	possibly damaging	Het
Sez6	G	A	11: 77,865,121 (GRCm39)	E623K	possibly damaging	Het
Slmap	T	C	14: 26,137,355 (GRCm39)		probably benign	Het
Sorl1	A	T	9: 41,975,050 (GRCm39)	N519K	possibly damaging	Het
Srebf2	A	T	15: 82,056,975 (GRCm39)	I237F	possibly damaging	Het
Szt2	T	C	4: 118,242,651 (GRCm39)	S1479G	possibly damaging	Het
Tbc1d24	C	A	17: 24,400,274 (GRCm39)	E537*	probably null	Het
Ttf1	T	A	2: 28,957,080 (GRCm39)	I450K	probably benign	Het
Ube2e2	A	G	14: 18,893,288 (GRCm38)	S2P	unknown	Het
Utp20	T	C	10: 88,611,180 (GRCm39)	N1379S	probably damaging	Het
Vmn2r25	C	T	6: 123,805,391 (GRCm39)	V489I	probably benign	Het
Wfdc8	C	T	2: 164,439,245 (GRCm39)	R379H	unknown	Het
Zeb2	C	T	2: 45,003,136 (GRCm39)		probably benign	Het
Zfp3	C	T	11: 70,663,241 (GRCm39)	T400I	probably benign	Het
Zfp760	T	C	17: 21,941,932 (GRCm39)	I369T	possibly damaging	Het

Other mutations in Cacna1e

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00551:Cacna1e	APN	1	154,279,429 (GRCm39)	missense	probably damaging	0.99
IGL01086:Cacna1e	APN	1	154,347,347 (GRCm39)	missense	probably benign	0.04
IGL01302:Cacna1e	APN	1	154,319,653 (GRCm39)	missense	probably damaging	1.00
IGL01386:Cacna1e	APN	1	154,348,123 (GRCm39)	missense	probably benign	0.18
IGL01573:Cacna1e	APN	1	154,347,113 (GRCm39)	missense	probably benign
IGL01676:Cacna1e	APN	1	154,288,196 (GRCm39)	missense	probably damaging	1.00
IGL01676:Cacna1e	APN	1	154,274,222 (GRCm39)	missense	probably damaging	1.00
IGL01762:Cacna1e	APN	1	154,347,119 (GRCm39)	missense	possibly damaging	0.78
IGL01801:Cacna1e	APN	1	154,347,086 (GRCm39)	missense	probably null	0.00
IGL01895:Cacna1e	APN	1	154,319,646 (GRCm39)	missense	probably damaging	1.00
IGL02391:Cacna1e	APN	1	154,296,859 (GRCm39)	missense	probably damaging	1.00
IGL02399:Cacna1e	APN	1	154,279,493 (GRCm39)	missense	probably damaging	1.00
IGL02659:Cacna1e	APN	1	154,302,274 (GRCm39)	missense	probably damaging	1.00
IGL02686:Cacna1e	APN	1	154,369,155 (GRCm39)	missense	probably damaging	1.00
IGL02838:Cacna1e	APN	1	154,321,394 (GRCm39)	missense	probably damaging	1.00
IGL02958:Cacna1e	APN	1	154,341,487 (GRCm39)	missense	probably damaging	1.00
IGL02981:Cacna1e	APN	1	154,347,171 (GRCm39)	missense	probably benign	0.15
IGL03120:Cacna1e	APN	1	154,319,627 (GRCm39)	missense	probably damaging	1.00
IGL03232:Cacna1e	APN	1	154,369,104 (GRCm39)	missense	probably damaging	1.00
IGL03310:Cacna1e	APN	1	154,317,997 (GRCm39)	missense	probably damaging	1.00
IGL03342:Cacna1e	APN	1	154,342,690 (GRCm39)	critical splice donor site	probably null
bezoar	UTSW	1	154,312,300 (GRCm39)	splice site	probably null
hairball	UTSW	1	154,355,051 (GRCm39)	missense	probably damaging	0.97
N/A - 535:Cacna1e	UTSW	1	154,341,510 (GRCm39)	missense	probably damaging	1.00
R0122:Cacna1e	UTSW	1	154,319,647 (GRCm39)	missense	probably damaging	1.00
R0143:Cacna1e	UTSW	1	154,324,693 (GRCm39)	splice site	probably null
R0314:Cacna1e	UTSW	1	154,317,997 (GRCm39)	missense	probably damaging	1.00
R0366:Cacna1e	UTSW	1	154,291,884 (GRCm39)	missense	probably benign	0.03
R0626:Cacna1e	UTSW	1	154,364,563 (GRCm39)	missense	probably damaging	0.99
R0739:Cacna1e	UTSW	1	154,318,024 (GRCm39)	missense	probably damaging	0.97
R1272:Cacna1e	UTSW	1	154,320,714 (GRCm39)	missense	probably damaging	1.00
R1300:Cacna1e	UTSW	1	154,274,419 (GRCm39)	missense	probably benign
R1340:Cacna1e	UTSW	1	154,348,403 (GRCm39)	missense	probably damaging	1.00
R1440:Cacna1e	UTSW	1	154,437,552 (GRCm39)	missense	possibly damaging	0.63
R1449:Cacna1e	UTSW	1	154,361,408 (GRCm39)	critical splice donor site	probably null
R1538:Cacna1e	UTSW	1	154,437,504 (GRCm39)	missense	probably damaging	0.99
R1542:Cacna1e	UTSW	1	154,353,525 (GRCm39)	missense	probably benign	0.01
R1560:Cacna1e	UTSW	1	154,296,850 (GRCm39)	nonsense	probably null
R1748:Cacna1e	UTSW	1	154,362,315 (GRCm39)	missense	possibly damaging	0.92
R1749:Cacna1e	UTSW	1	154,319,746 (GRCm39)	missense	probably damaging	1.00
R1912:Cacna1e	UTSW	1	154,312,195 (GRCm39)	missense	probably damaging	1.00
R1968:Cacna1e	UTSW	1	154,576,240 (GRCm39)	missense	probably damaging	1.00
R1993:Cacna1e	UTSW	1	154,353,563 (GRCm39)	missense	probably damaging	0.97
R1994:Cacna1e	UTSW	1	154,353,563 (GRCm39)	missense	probably damaging	0.97
R2191:Cacna1e	UTSW	1	154,319,591 (GRCm39)	missense	probably damaging	1.00
R2291:Cacna1e	UTSW	1	154,279,429 (GRCm39)	missense	probably damaging	0.99
R2417:Cacna1e	UTSW	1	154,347,939 (GRCm39)	missense	probably damaging	1.00
R3608:Cacna1e	UTSW	1	154,291,831 (GRCm39)	missense	probably benign	0.08
R3757:Cacna1e	UTSW	1	154,509,442 (GRCm39)	missense	probably damaging	0.97
R3890:Cacna1e	UTSW	1	154,359,299 (GRCm39)	missense	probably damaging	1.00
R4015:Cacna1e	UTSW	1	154,358,331 (GRCm39)	missense	probably damaging	1.00
R4088:Cacna1e	UTSW	1	154,287,929 (GRCm39)	splice site	probably null
R4275:Cacna1e	UTSW	1	154,369,071 (GRCm39)	missense	probably damaging	1.00
R4282:Cacna1e	UTSW	1	154,302,296 (GRCm39)	missense	probably benign	0.04
R4297:Cacna1e	UTSW	1	154,274,477 (GRCm39)	missense	probably benign	0.37
R4356:Cacna1e	UTSW	1	154,319,727 (GRCm39)	missense	probably damaging	1.00
R4510:Cacna1e	UTSW	1	154,437,579 (GRCm39)	missense	probably damaging	1.00
R4511:Cacna1e	UTSW	1	154,437,579 (GRCm39)	missense	probably damaging	1.00
R4577:Cacna1e	UTSW	1	154,277,773 (GRCm39)	missense	possibly damaging	0.92
R4590:Cacna1e	UTSW	1	154,312,265 (GRCm39)	missense	possibly damaging	0.87
R4601:Cacna1e	UTSW	1	154,347,359 (GRCm39)	missense	probably benign
R4622:Cacna1e	UTSW	1	154,347,311 (GRCm39)	missense	possibly damaging	0.81
R4626:Cacna1e	UTSW	1	154,358,294 (GRCm39)	splice site	probably null
R4694:Cacna1e	UTSW	1	154,313,012 (GRCm39)	critical splice donor site	probably null
R4727:Cacna1e	UTSW	1	154,312,214 (GRCm39)	nonsense	probably null
R4839:Cacna1e	UTSW	1	154,296,804 (GRCm39)	missense	probably damaging	1.00
R4851:Cacna1e	UTSW	1	154,312,300 (GRCm39)	splice site	probably null
R4894:Cacna1e	UTSW	1	154,364,551 (GRCm39)	nonsense	probably null
R4934:Cacna1e	UTSW	1	154,357,380 (GRCm39)	nonsense	probably null
R4979:Cacna1e	UTSW	1	154,289,739 (GRCm39)	missense	probably damaging	1.00
R5077:Cacna1e	UTSW	1	154,437,475 (GRCm39)	critical splice donor site	probably null
R5128:Cacna1e	UTSW	1	154,277,767 (GRCm39)	missense	probably damaging	0.98
R5214:Cacna1e	UTSW	1	154,577,110 (GRCm39)	missense	possibly damaging	0.93
R5274:Cacna1e	UTSW	1	154,576,250 (GRCm39)	missense	probably damaging	0.98
R5388:Cacna1e	UTSW	1	154,353,542 (GRCm39)	missense	probably damaging	1.00
R5416:Cacna1e	UTSW	1	154,341,525 (GRCm39)	missense	probably damaging	1.00
R5469:Cacna1e	UTSW	1	154,319,683 (GRCm39)	missense	probably damaging	1.00
R5475:Cacna1e	UTSW	1	154,601,455 (GRCm39)	missense	possibly damaging	0.53
R5607:Cacna1e	UTSW	1	154,347,086 (GRCm39)	missense	probably benign	0.00
R5615:Cacna1e	UTSW	1	154,287,916 (GRCm39)	missense	probably damaging	1.00
R5616:Cacna1e	UTSW	1	154,317,940 (GRCm39)	missense	probably damaging	1.00
R5627:Cacna1e	UTSW	1	154,511,604 (GRCm39)	missense	probably damaging	0.98
R5707:Cacna1e	UTSW	1	154,509,463 (GRCm39)	missense	probably damaging	1.00
R5756:Cacna1e	UTSW	1	154,347,383 (GRCm39)	missense	probably benign	0.00
R5893:Cacna1e	UTSW	1	154,313,069 (GRCm39)	missense	probably damaging	1.00
R6117:Cacna1e	UTSW	1	154,437,537 (GRCm39)	missense	possibly damaging	0.68
R6134:Cacna1e	UTSW	1	154,577,037 (GRCm39)	missense	probably damaging	1.00
R6190:Cacna1e	UTSW	1	154,362,316 (GRCm39)	missense	possibly damaging	0.47
R6279:Cacna1e	UTSW	1	154,301,678 (GRCm39)	missense	probably benign	0.38
R6295:Cacna1e	UTSW	1	154,317,919 (GRCm39)	missense	probably damaging	0.98
R6300:Cacna1e	UTSW	1	154,301,678 (GRCm39)	missense	probably benign	0.38
R6320:Cacna1e	UTSW	1	154,317,270 (GRCm39)	missense	possibly damaging	0.76
R6375:Cacna1e	UTSW	1	154,355,051 (GRCm39)	missense	probably damaging	0.97
R6830:Cacna1e	UTSW	1	154,289,720 (GRCm39)	critical splice donor site	probably null
R6842:Cacna1e	UTSW	1	154,358,863 (GRCm39)	missense	probably damaging	1.00
R7023:Cacna1e	UTSW	1	154,601,439 (GRCm39)	missense	probably null	0.85
R7081:Cacna1e	UTSW	1	154,576,129 (GRCm39)	missense	possibly damaging	0.82
R7085:Cacna1e	UTSW	1	154,349,492 (GRCm39)	splice site	probably null
R7108:Cacna1e	UTSW	1	154,344,741 (GRCm39)	frame shift	probably null
R7142:Cacna1e	UTSW	1	154,288,230 (GRCm39)	missense	probably damaging	1.00
R7250:Cacna1e	UTSW	1	154,576,235 (GRCm39)	missense	possibly damaging	0.93
R7332:Cacna1e	UTSW	1	154,601,547 (GRCm39)	missense	possibly damaging	0.89
R7410:Cacna1e	UTSW	1	154,347,980 (GRCm39)	missense	probably benign	0.13
R7502:Cacna1e	UTSW	1	154,344,734 (GRCm39)	missense	probably null	0.35
R7556:Cacna1e	UTSW	1	154,348,419 (GRCm39)	missense	probably benign	0.28
R7563:Cacna1e	UTSW	1	154,347,162 (GRCm39)	missense	probably benign	0.00
R7573:Cacna1e	UTSW	1	154,601,911 (GRCm39)	intron	probably benign
R7689:Cacna1e	UTSW	1	154,274,549 (GRCm39)	missense	probably benign	0.01
R7699:Cacna1e	UTSW	1	154,319,674 (GRCm39)	missense	probably damaging	1.00
R7744:Cacna1e	UTSW	1	154,341,538 (GRCm39)	missense	probably damaging	1.00
R7754:Cacna1e	UTSW	1	154,288,863 (GRCm39)	missense	probably damaging	0.97
R7787:Cacna1e	UTSW	1	154,358,314 (GRCm39)	missense	probably damaging	0.98
R7818:Cacna1e	UTSW	1	154,274,152 (GRCm39)	missense	probably damaging	1.00
R7838:Cacna1e	UTSW	1	154,347,149 (GRCm39)	missense	probably benign	0.08
R7849:Cacna1e	UTSW	1	154,509,464 (GRCm39)	missense	probably damaging	1.00
R8011:Cacna1e	UTSW	1	154,341,568 (GRCm39)	missense	probably benign	0.01
R8094:Cacna1e	UTSW	1	154,437,516 (GRCm39)	missense	probably damaging	1.00
R8162:Cacna1e	UTSW	1	154,577,313 (GRCm39)	splice site	probably null
R8202:Cacna1e	UTSW	1	154,274,195 (GRCm39)	missense	probably benign
R8280:Cacna1e	UTSW	1	154,344,839 (GRCm39)	missense	probably damaging	0.97
R8354:Cacna1e	UTSW	1	154,274,314 (GRCm39)	missense	probably damaging	1.00
R8385:Cacna1e	UTSW	1	154,319,687 (GRCm39)	missense	probably damaging	0.98
R8532:Cacna1e	UTSW	1	154,341,510 (GRCm39)	missense	probably damaging	1.00
R8902:Cacna1e	UTSW	1	154,349,632 (GRCm39)	missense	probably benign	0.01
R8926:Cacna1e	UTSW	1	154,577,080 (GRCm39)	missense	possibly damaging	0.84
R8947:Cacna1e	UTSW	1	154,277,896 (GRCm39)	missense	probably benign	0.10
R9126:Cacna1e	UTSW	1	154,343,510 (GRCm39)	missense	probably benign	0.01
R9175:Cacna1e	UTSW	1	154,274,314 (GRCm39)	missense	probably damaging	1.00
R9286:Cacna1e	UTSW	1	154,288,845 (GRCm39)	missense	probably damaging	1.00
R9377:Cacna1e	UTSW	1	154,361,458 (GRCm39)	missense	possibly damaging	0.88
R9452:Cacna1e	UTSW	1	154,289,720 (GRCm39)	critical splice donor site	probably null
R9463:Cacna1e	UTSW	1	154,357,411 (GRCm39)	missense	probably damaging	1.00
R9513:Cacna1e	UTSW	1	154,318,033 (GRCm39)	missense	probably damaging	1.00
R9534:Cacna1e	UTSW	1	154,320,693 (GRCm39)	missense	possibly damaging	0.65
R9562:Cacna1e	UTSW	1	154,283,486 (GRCm39)	missense	probably benign	0.01
RF008:Cacna1e	UTSW	1	154,317,882 (GRCm39)	missense	probably damaging	1.00
X0062:Cacna1e	UTSW	1	154,288,238 (GRCm39)	missense	probably damaging	1.00
Z1176:Cacna1e	UTSW	1	154,511,596 (GRCm39)	missense	probably damaging	0.98
Z1177:Cacna1e	UTSW	1	154,318,038 (GRCm39)	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- AGGGACCCTTACTGAATCAAAGC -3'
(R):5'- CCCCTCATAAGTTGTTTGATTCAGG -3'

Sequencing Primer
(F):5'- GGACCCTTACTGAATCAAAGCTCAAC -3'
(R):5'- TGGCCTTAGCAACGTCTT -3'

Posted On

2021-12-30