Incidental Mutation 'R9135:Olfr1434'
ID 693985
Institutional Source Beutler Lab
Gene Symbol Olfr1434
Ensembl Gene ENSMUSG00000095640
Gene Name olfactory receptor 1434
Synonyms MOR214-4, Olfr1433, MOR214-4, GA_x6K02T2RE5P-2618516-2619454, GA_x6K02T2RE5P-2610001-2610414
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.088) question?
Stock # R9135 (G1)
Quality Score 225.009
Status Not validated
Chromosome 19
Chromosomal Location 12279854-12285626 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to A at 12283444 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Leucine to Glutamine at position 132 (L132Q)
Ref Sequence ENSEMBL: ENSMUSP00000146925 (fasta)
AlphaFold Q7TQR9
Predicted Effect probably damaging
Transcript: ENSMUST00000207186
AA Change: L132Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably benign
Transcript: ENSMUST00000207915
Predicted Effect probably damaging
Transcript: ENSMUST00000208197
AA Change: L132Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 116 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110008L16Rik T A 12: 55,379,404 L513Q probably damaging Het
Abcb9 T C 5: 124,090,113 T22A possibly damaging Het
Abi3bp A G 16: 56,596,810 D419G probably benign Het
Acoxl A T 2: 127,854,771 probably benign Het
Acvr1 T C 2: 58,462,971 T326A possibly damaging Het
Adgra2 T C 8: 27,120,951 L976P probably damaging Het
Adora2b A G 11: 62,265,060 probably null Het
Ak1 A T 2: 32,631,170 Q117L probably damaging Het
Akr1c14 T A 13: 4,078,029 D143E probably damaging Het
Ap4e1 A T 2: 127,019,322 H127L probably damaging Het
Asxl3 T A 18: 22,516,613 I553N probably damaging Het
Asxl3 T A 18: 22,524,424 N1830K possibly damaging Het
Atp11a G A 8: 12,813,144 A108T probably damaging Het
Bag6 A G 17: 35,143,461 T582A unknown Het
Bbs9 T C 9: 22,578,709 S259P probably damaging Het
Bean1 CT C 8: 104,182,032 probably null Het
Blvrb T C 7: 27,465,785 S177P probably damaging Het
C1s2 T A 6: 124,625,683 D523V probably benign Het
Cacna2d1 C T 5: 16,353,852 T736I probably damaging Het
Card9 T C 2: 26,352,385 N513S probably benign Het
Casp2 A G 6: 42,268,948 T180A probably benign Het
Cenpf A T 1: 189,672,549 L361Q probably damaging Het
Cnbd2 T C 2: 156,375,568 I659T probably damaging Het
Cped1 A T 6: 21,987,013 D68V probably damaging Het
Cxcr1 T C 1: 74,191,940 I308V probably benign Het
Dad1 A G 14: 54,253,706 L46P probably damaging Het
Defb23 G A 2: 152,459,502 A50V probably benign Het
Dhx33 C T 11: 70,987,166 A684T probably damaging Het
Epb41l4a T A 18: 33,832,676 N366I probably benign Het
Erich3 A G 3: 154,762,275 E788G Het
Fam241b T C 10: 62,109,113 N35S probably benign Het
Fbxo24 T A 5: 137,624,264 Q80L probably benign Het
Foxk1 T G 5: 142,448,742 F254V probably benign Het
Gm10801 C CGTG 2: 98,663,807 probably null Het
Gm12886 T C 4: 121,417,546 I46V probably benign Het
Gm20834 G T Y: 10,323,354 H27Q probably damaging Het
Gm2888 A G 14: 3,032,106 N138S probably damaging Het
Gm5773 T C 3: 93,773,872 C284R possibly damaging Het
Gprin3 A T 6: 59,353,288 M678K probably benign Het
Grm7 T C 6: 111,495,768 V856A probably benign Het
Il18rap C T 1: 40,543,017 T366M probably benign Het
Immt C T 6: 71,874,419 T588I probably damaging Het
Ints1 G C 5: 139,751,946 N2145K possibly damaging Het
Jade2 T C 11: 51,825,124 D418G probably benign Het
Kdf1 T C 4: 133,528,829 Y286H probably damaging Het
Kif18a A G 2: 109,341,161 Y861C possibly damaging Het
Lama2 T A 10: 27,422,519 I194F probably damaging Het
Lhx8 A G 3: 154,328,426 S33P probably benign Het
Lmo7 T C 14: 101,880,861 I174T probably damaging Het
Lrfn2 A T 17: 49,069,948 D19V possibly damaging Het
Lrrk1 A T 7: 66,278,609 I1257N probably damaging Het
Malrd1 T A 2: 15,797,705 H1076Q unknown Het
Map3k14 A C 11: 103,237,538 M419R probably damaging Het
Mcm10 G A 2: 5,006,561 R200C probably benign Het
Mertk A G 2: 128,762,115 N390D probably benign Het
Mitf T A 6: 98,013,719 I361N probably damaging Het
Mrgprb1 T A 7: 48,447,298 I289F possibly damaging Het
Muc5ac A T 7: 141,798,481 D659V probably damaging Het
Nox4 G A 7: 87,376,240 R525Q probably benign Het
Nphp3 T G 9: 104,032,015 L808R probably damaging Het
Olfr1467 T A 19: 13,365,391 S254R possibly damaging Het
Olfr20 T C 11: 73,354,490 S246P probably damaging Het
Olfr296-ps1 G A 7: 86,561,948 C72Y unknown Het
Pagr1a T C 7: 127,016,782 E47G probably benign Het
Papss2 G T 19: 32,641,364 R274L probably damaging Het
Pcdhga10 C A 18: 37,747,907 F240L probably damaging Het
Pcsk5 T G 19: 17,586,108 E555A Het
Peg10 C CTCA 6: 4,756,453 probably benign Het
Pgrmc2 T A 3: 41,068,664 D206V probably damaging Het
Pkd1 T C 17: 24,572,002 V1057A Het
Plekha5 T C 6: 140,534,513 I113T probably damaging Het
Prss32 C T 17: 23,859,225 T295I possibly damaging Het
Ptprk G T 10: 28,580,417 V1072F probably damaging Het
Rasd2 T A 8: 75,218,546 M1K probably null Het
Rhag T A 17: 40,828,411 M79K probably damaging Het
Rnf19a C A 15: 36,253,164 probably null Het
Rnf213 G T 11: 119,408,747 G101C Het
Sap130 T A 18: 31,647,063 D45E probably benign Het
Scel T A 14: 103,602,190 F510I probably benign Het
Sertad2 A T 11: 20,648,425 E207V probably benign Het
Shoc2 T A 19: 53,987,879 S67T probably benign Het
Slc22a3 T C 17: 12,426,732 I441V possibly damaging Het
Slfn5 A G 11: 82,960,677 D600G probably benign Het
Smim7 G A 8: 72,570,913 T10M probably damaging Het
Sntb2 A T 8: 106,936,199 Q133L possibly damaging Het
Steap3 A C 1: 120,234,318 M408R probably benign Het
Supt4a T C 11: 87,742,798 I60T probably benign Het
Swt1 A C 1: 151,368,488 C899G possibly damaging Het
Taok3 A G 5: 117,206,679 E157G probably damaging Het
Taok3 T C 5: 117,241,103 V401A probably benign Het
Taok3 C T 5: 117,241,180 L427F possibly damaging Het
Tcf25 A G 8: 123,381,443 E79G probably benign Het
Tigit G A 16: 43,659,513 L140F possibly damaging Het
Tmem143 G T 7: 45,897,378 probably benign Het
Tmem151b C T 17: 45,545,429 V362M possibly damaging Het
Tmem230 A G 2: 132,244,069 F58L probably benign Het
Trim25 T C 11: 89,009,162 M245T probably benign Het
Trim36 A C 18: 46,169,343 V546G probably benign Het
Triml1 T C 8: 43,130,587 N326D probably damaging Het
Trp53bp2 T C 1: 182,458,763 V1056A probably damaging Het
Trpa1 C A 1: 14,882,211 M865I probably damaging Het
Ttbk1 A T 17: 46,479,206 Y104* probably null Het
Tubg1 T A 11: 101,123,431 H139Q probably damaging Het
Ufsp2 A G 8: 45,994,013 probably null Het
Uhrf1bp1 T A 17: 27,885,928 L532* probably null Het
Usp47 A T 7: 112,053,224 N36I probably benign Het
Vmn1r32 G A 6: 66,553,136 R219* probably null Het
Vmn2r59 G A 7: 42,043,701 P492S probably benign Het
Vmn2r59 G C 7: 42,043,703 A491G Het
Wdr63 T C 3: 146,066,834 T486A probably benign Het
Wdr76 T C 2: 121,534,111 Y299H probably damaging Het
Wnt5a C T 14: 28,518,352 A153V probably benign Het
Zfp202 T C 9: 40,208,941 V226A possibly damaging Het
Zfp219 C T 14: 52,007,141 R527H probably damaging Het
Zfp408 A T 2: 91,645,183 L542H probably damaging Het
Zfyve9 A T 4: 108,682,189 C271* probably null Het
Other mutations in Olfr1434
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01933:Olfr1434 APN 19 12283705 missense probably damaging 1.00
IGL02415:Olfr1434 APN 19 12283498 missense probably benign 0.44
IGL02731:Olfr1434 APN 19 12283842 missense probably damaging 0.99
IGL02803:Olfr1434 APN 19 12283983 missense possibly damaging 0.94
IGL03050:Olfr1434 UTSW 19 12283512 missense probably benign
R0432:Olfr1434 UTSW 19 12283903 missense probably damaging 1.00
R2209:Olfr1434 UTSW 19 12283860 missense probably benign 0.41
R3710:Olfr1434 UTSW 19 12283086 missense probably damaging 1.00
R4724:Olfr1434 UTSW 19 12283096 missense probably damaging 1.00
R5133:Olfr1434 UTSW 19 12283306 missense possibly damaging 0.96
R5974:Olfr1434 UTSW 19 12283836 missense probably damaging 1.00
R6544:Olfr1434 UTSW 19 12283155 missense probably damaging 1.00
R7225:Olfr1434 UTSW 19 12283467 missense probably benign 0.00
R7320:Olfr1434 UTSW 19 12283816 missense possibly damaging 0.72
R7467:Olfr1434 UTSW 19 12283475 nonsense probably null
R7900:Olfr1434 UTSW 19 12283341 missense probably damaging 1.00
R8719:Olfr1434 UTSW 19 12283428 missense probably benign 0.13
R9324:Olfr1434 UTSW 19 12283575 missense probably benign 0.30
Predicted Primers PCR Primer
(F):5'- GGACTCCTATCTCCATACACCTATG -3'
(R):5'- GATTTAACAGCTGGGGCATG -3'

Sequencing Primer
(F):5'- TCCTCAGTAATCTGTCCTTTATAGAC -3'
(R):5'- TAACAGCTGGGGCATGTCACAG -3'
Posted On 2022-01-20