Incidental Mutation 'R9232:Trim28'
ID 700296
Institutional Source Beutler Lab
Gene Symbol Trim28
Ensembl Gene ENSMUSG00000005566
Gene Name tripartite motif-containing 28
Synonyms KRIP-1, Tif1b, KAP-1, MommeD9
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R9232 (G1)
Quality Score 225.009
Status Validated
Chromosome 7
Chromosomal Location 12999114-13031035 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) G to A at 13029563 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Alanine to Threonine at position 544 (A544T)
Ref Sequence ENSEMBL: ENSMUSP00000005705 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000005705] [ENSMUST00000005711] [ENSMUST00000210587] [ENSMUST00000211344] [ENSMUST00000211369] [ENSMUST00000211626]
AlphaFold Q62318
Predicted Effect probably benign
Transcript: ENSMUST00000005705
AA Change: A544T

PolyPhen 2 Score 0.246 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000005705
Gene: ENSMUSG00000005566
AA Change: A544T

DomainStartEndE-ValueType
low complexity region 2 34 N/A INTRINSIC
low complexity region 37 57 N/A INTRINSIC
RING 66 121 1.2e-7 SMART
BBOX 149 196 2.97e-12 SMART
BBOX 205 246 1.11e-11 SMART
BBC 253 379 7.92e-39 SMART
low complexity region 420 432 N/A INTRINSIC
low complexity region 525 551 N/A INTRINSIC
low complexity region 555 576 N/A INTRINSIC
PHD 627 670 2.16e-9 SMART
RING 628 669 8.32e0 SMART
BROMO 697 801 6.5e-7 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000005711
SMART Domains Protein: ENSMUSP00000005711
Gene: ENSMUSG00000033916

DomainStartEndE-ValueType
Pfam:Snf7 17 187 9.5e-50 PFAM
coiled coil region 196 222 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000210587
Predicted Effect probably benign
Transcript: ENSMUST00000211344
Predicted Effect probably benign
Transcript: ENSMUST00000211369
Predicted Effect probably benign
Transcript: ENSMUST00000211626
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency 98% (53/54)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene mediates transcriptional control by interaction with the Kruppel-associated box repression domain found in many transcription factors. The protein localizes to the nucleus and is thought to associate with specific chromatin regions. The protein is a member of the tripartite motif family. This tripartite motif includes three zinc-binding domains, a RING, a B-box type 1 and a B-box type 2, and a coiled-coil region. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for a targeted disruption of this gene develop normally until the blastocyst stage and undergo uterine implantation, but become arrested at the early egg-cylinder stage, fail to gastrulate, and are completely resorbed by E8.5. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abhd3 A T 18: 10,652,198 S278T probably benign Het
Adgrf1 T C 17: 43,310,404 Y511H probably benign Het
Atp5h A G 11: 115,418,395 F38S probably benign Het
Cdc6 T G 11: 98,910,375 S151A probably benign Het
Ceacam12 T A 7: 18,069,416 M249K probably benign Het
Cenpt T C 8: 105,845,161 Q446R probably damaging Het
Cnnm1 T A 19: 43,491,886 S883T probably benign Het
Cntn6 T C 6: 104,838,820 W721R probably damaging Het
Defb43 A G 14: 63,017,832 K38R probably damaging Het
Eif2a T C 3: 58,555,601 S522P probably benign Het
Erap1 T G 13: 74,663,518 S332R probably benign Het
Foxa3 C A 7: 19,014,865 R112L probably damaging Het
Foxf1 T A 8: 121,084,976 M193K possibly damaging Het
Gbp11 T C 5: 105,328,424 Y273C possibly damaging Het
Gli2 T A 1: 118,836,291 T1377S probably benign Het
Gm10271 T A 10: 116,972,574 L12F probably damaging Het
Gm13023 T G 4: 143,793,693 L169R probably benign Het
Grm5 G A 7: 88,074,383 G627D probably damaging Het
Gtf3c4 A G 2: 28,834,836 S295P probably damaging Het
Hps4 G A 5: 112,378,039 S642N possibly damaging Het
Igsf10 G A 3: 59,336,422 R164W probably damaging Het
Iqch T A 9: 63,421,918 M1045L probably benign Het
Kcnt2 T C 1: 140,484,193 S455P possibly damaging Het
Kif26b G A 1: 178,914,946 G869E probably damaging Het
Kit A G 5: 75,639,132 N508S probably benign Het
Lgals8 C T 13: 12,454,896 V61M probably damaging Het
Lztr1 T C 16: 17,521,479 V392A possibly damaging Het
Mad1l1 T A 5: 140,105,541 M524L probably benign Het
Mob3b T C 4: 34,986,101 N146D probably benign Het
Muc16 T C 9: 18,656,040 T1728A unknown Het
Nlgn2 T C 11: 69,828,029 H278R probably damaging Het
Nlgn3 T C X: 101,308,784 V179A probably damaging Het
Plce1 A G 19: 38,716,979 M943V probably benign Het
Proser2 A G 2: 6,101,204 L183P probably benign Het
Prss36 T C 7: 127,944,816 I128V probably benign Het
Rabggta C T 14: 55,719,288 V320I probably benign Het
Sepsecs A G 5: 52,666,002 V125A probably benign Het
Sik3 C T 9: 46,211,918 P1005L probably benign Het
Slc22a20 A T 19: 5,972,981 I378N possibly damaging Het
Son CATGGACTCCCAGATGTTAGCAACTAGCTCTATGGACTCCCAGATGTTAGCAACTAGCTCTATGGACTCCCAGATGTTAGCAACCAGCAGTATGGACTCCCAGATGTTAGCAACCAGCAGTATGGACTCCCAGATGTTAGCAACCAGCTCCATGGACTCCCAGATGTTAGCAAC CATGGACTCCCAGATGTTAGCAACTAGCTCTATGGACTCCCAGATGTTAGCAACCAGCAGTATGGACTCCCAGATGTTAGCAACCAGCAGTATGGACTCCCAGATGTTAGCAACCAGCTCCATGGACTCCCAGATGTTAGCAAC 16: 91,656,691 probably benign Het
Tap1 T C 17: 34,193,303 V494A probably benign Het
Tg A G 15: 66,698,461 D1394G probably benign Het
Tgfbr3 T C 5: 107,142,495 T315A possibly damaging Het
Tmc2 A G 2: 130,243,129 T559A probably damaging Het
Tph1 A G 7: 46,662,105 I71T probably benign Het
Trib3 A T 2: 152,343,042 C96S probably damaging Het
Trim56 A G 5: 137,112,778 V628A probably damaging Het
Ttc6 A G 12: 57,729,424 Y1718C probably damaging Het
Tuft1 T C 3: 94,622,138 Q244R probably benign Het
Unc13b A G 4: 43,240,321 T793A probably benign Het
Vmn1r39 A G 6: 66,804,596 I246T possibly damaging Het
Xpo1 T C 11: 23,282,646 S389P probably benign Het
Zdbf2 T C 1: 63,308,009 F1849S possibly damaging Het
Other mutations in Trim28
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01778:Trim28 APN 7 13030702 missense probably damaging 1.00
R0113:Trim28 UTSW 7 13028701 missense probably damaging 1.00
R0610:Trim28 UTSW 7 13025784 splice site probably benign
R1558:Trim28 UTSW 7 13027834 missense probably damaging 1.00
R1650:Trim28 UTSW 7 13030849 missense possibly damaging 0.79
R3120:Trim28 UTSW 7 13028414 missense probably damaging 1.00
R4022:Trim28 UTSW 7 13028558 unclassified probably benign
R4173:Trim28 UTSW 7 13029878 missense probably benign 0.00
R4237:Trim28 UTSW 7 13027911 missense possibly damaging 0.94
R4379:Trim28 UTSW 7 13029480 missense probably damaging 0.99
R5206:Trim28 UTSW 7 13025348 missense probably benign 0.01
R5754:Trim28 UTSW 7 13029109 missense probably benign 0.12
R6788:Trim28 UTSW 7 13025346 missense probably benign 0.00
R6864:Trim28 UTSW 7 13029458 missense possibly damaging 0.85
R7089:Trim28 UTSW 7 13024906 missense probably damaging 0.99
R7588:Trim28 UTSW 7 13029420 missense probably damaging 1.00
R7677:Trim28 UTSW 7 13028113 missense possibly damaging 0.92
R7861:Trim28 UTSW 7 13028412 missense possibly damaging 0.67
R7878:Trim28 UTSW 7 13024362 start gained probably benign
R8814:Trim28 UTSW 7 13028527 missense probably damaging 0.96
R9226:Trim28 UTSW 7 13029563 missense probably benign 0.25
R9231:Trim28 UTSW 7 13029563 missense probably benign 0.25
R9233:Trim28 UTSW 7 13029563 missense probably benign 0.25
R9235:Trim28 UTSW 7 13029563 missense probably benign 0.25
R9236:Trim28 UTSW 7 13029563 missense probably benign 0.25
R9518:Trim28 UTSW 7 13030518 missense probably damaging 1.00
X0050:Trim28 UTSW 7 13029471 missense probably benign 0.10
Predicted Primers PCR Primer
(F):5'- GTAAGTGGCCTCTTAAGGAAGG -3'
(R):5'- CCTTCAGTCAGAGGCATCAAC -3'

Sequencing Primer
(F):5'- CTCTTAAGGAAGGTGCCACGTG -3'
(R):5'- CAACACAGGCTTGGTTTCAG -3'
Posted On 2022-02-07