Incidental Mutation 'R9232:Lgals8'
ID 700313
Institutional Source Beutler Lab
Gene Symbol Lgals8
Ensembl Gene ENSMUSG00000057554
Gene Name lectin, galactose binding, soluble 8
Synonyms Lgals-8, 1200015E08Rik, D13Ertd524e
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.151) question?
Stock # R9232 (G1)
Quality Score 225.009
Status Not validated
Chromosome 13
Chromosomal Location 12439415-12464944 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) C to T at 12454896 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Valine to Methionine at position 61 (V61M)
Ref Sequence ENSEMBL: ENSMUSP00000115094 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000099820] [ENSMUST00000099821] [ENSMUST00000124888] [ENSMUST00000135166] [ENSMUST00000143693] [ENSMUST00000144283]
AlphaFold Q9JL15
Predicted Effect probably damaging
Transcript: ENSMUST00000099820
AA Change: V61M

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000097408
Gene: ENSMUSG00000057554
AA Change: V61M

DomainStartEndE-ValueType
GLECT 16 151 3.05e-50 SMART
Gal-bind_lectin 22 150 7.41e-55 SMART
GLECT 184 316 1.38e-48 SMART
Gal-bind_lectin 190 315 1.28e-49 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000099821
AA Change: V61M

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000097409
Gene: ENSMUSG00000057554
AA Change: V61M

DomainStartEndE-ValueType
GLECT 16 151 3.05e-50 SMART
Gal-bind_lectin 22 150 7.41e-55 SMART
GLECT 184 316 1.38e-48 SMART
Gal-bind_lectin 190 315 1.28e-49 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000124888
AA Change: V61M

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000115094
Gene: ENSMUSG00000057554
AA Change: V61M

DomainStartEndE-ValueType
GLECT 16 151 3.05e-50 SMART
Gal-bind_lectin 22 150 7.41e-55 SMART
GLECT 184 316 1.38e-48 SMART
Gal-bind_lectin 190 315 1.28e-49 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000135166
SMART Domains Protein: ENSMUSP00000120210
Gene: ENSMUSG00000057554

DomainStartEndE-ValueType
Pfam:Gal-bind_lectin 1 57 4e-16 PFAM
GLECT 91 223 1.38e-48 SMART
Gal-bind_lectin 97 222 1.28e-49 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000143693
SMART Domains Protein: ENSMUSP00000118925
Gene: ENSMUSG00000057554

DomainStartEndE-ValueType
Pfam:Gal-bind_lectin 1 57 4e-16 PFAM
GLECT 91 223 1.38e-48 SMART
Gal-bind_lectin 97 222 1.28e-49 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000144283
AA Change: V61M

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000114200
Gene: ENSMUSG00000057554
AA Change: V61M

DomainStartEndE-ValueType
GLECT 16 151 3.05e-50 SMART
Gal-bind_lectin 22 150 7.41e-55 SMART
GLECT 193 325 1.38e-48 SMART
Gal-bind_lectin 199 324 1.28e-49 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the galectin family. Galectins are beta-galactoside-binding animal lectins with conserved carbohydrate recognition domains. The galectins have been implicated in many essential functions including development, differentiation, cell-cell adhesion, cell-matrix interaction, growth regulation, apoptosis, and RNA splicing. This gene is widely expressed in tumoral tissues and seems to be involved in integrin-like cell interactions. Alternatively spliced transcript variants encoding different isoforms have been identified. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit reduced VEGF-C-induced lymphangiogenesis, and ameliorated corneal pathology and lymphangiogenesis in a model of herpes simplex virus keratitis. Mice homozygous for a gene trapped allele exhibit hyperactivity. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abhd3 A T 18: 10,652,198 S278T probably benign Het
Adgrf1 T C 17: 43,310,404 Y511H probably benign Het
Atp5h A G 11: 115,418,395 F38S probably benign Het
Cdc6 T G 11: 98,910,375 S151A probably benign Het
Ceacam12 T A 7: 18,069,416 M249K probably benign Het
Cenpt T C 8: 105,845,161 Q446R probably damaging Het
Cnnm1 T A 19: 43,491,886 S883T probably benign Het
Cntn6 T C 6: 104,838,820 W721R probably damaging Het
Defb43 A G 14: 63,017,832 K38R probably damaging Het
Eif2a T C 3: 58,555,601 S522P probably benign Het
Erap1 T G 13: 74,663,518 S332R probably benign Het
Foxa3 C A 7: 19,014,865 R112L probably damaging Het
Foxf1 T A 8: 121,084,976 M193K possibly damaging Het
Gbp11 T C 5: 105,328,424 Y273C possibly damaging Het
Gli2 T A 1: 118,836,291 T1377S probably benign Het
Gm10271 T A 10: 116,972,574 L12F probably damaging Het
Gm13023 T G 4: 143,793,693 L169R probably benign Het
Grm5 G A 7: 88,074,383 G627D probably damaging Het
Gtf3c4 A G 2: 28,834,836 S295P probably damaging Het
Hps4 G A 5: 112,378,039 S642N possibly damaging Het
Igsf10 G A 3: 59,336,422 R164W probably damaging Het
Iqch T A 9: 63,421,918 M1045L probably benign Het
Kcnt2 T C 1: 140,484,193 S455P possibly damaging Het
Kif26b G A 1: 178,914,946 G869E probably damaging Het
Kit A G 5: 75,639,132 N508S probably benign Het
Lztr1 T C 16: 17,521,479 V392A possibly damaging Het
Mad1l1 T A 5: 140,105,541 M524L probably benign Het
Mob3b T C 4: 34,986,101 N146D probably benign Het
Muc16 T C 9: 18,656,040 T1728A unknown Het
Nlgn2 T C 11: 69,828,029 H278R probably damaging Het
Nlgn3 T C X: 101,308,784 V179A probably damaging Het
Plce1 A G 19: 38,716,979 M943V probably benign Het
Proser2 A G 2: 6,101,204 L183P probably benign Het
Prss36 T C 7: 127,944,816 I128V probably benign Het
Rabggta C T 14: 55,719,288 V320I probably benign Het
Sepsecs A G 5: 52,666,002 V125A probably benign Het
Sik3 C T 9: 46,211,918 P1005L probably benign Het
Slc22a20 A T 19: 5,972,981 I378N possibly damaging Het
Son CATGGACTCCCAGATGTTAGCAACTAGCTCTATGGACTCCCAGATGTTAGCAACTAGCTCTATGGACTCCCAGATGTTAGCAACCAGCAGTATGGACTCCCAGATGTTAGCAACCAGCAGTATGGACTCCCAGATGTTAGCAACCAGCTCCATGGACTCCCAGATGTTAGCAAC CATGGACTCCCAGATGTTAGCAACTAGCTCTATGGACTCCCAGATGTTAGCAACCAGCAGTATGGACTCCCAGATGTTAGCAACCAGCAGTATGGACTCCCAGATGTTAGCAACCAGCTCCATGGACTCCCAGATGTTAGCAAC 16: 91,656,691 probably benign Het
Tap1 T C 17: 34,193,303 V494A probably benign Het
Tg A G 15: 66,698,461 D1394G probably benign Het
Tgfbr3 T C 5: 107,142,495 T315A possibly damaging Het
Tmc2 A G 2: 130,243,129 T559A probably damaging Het
Tph1 A G 7: 46,662,105 I71T probably benign Het
Trib3 A T 2: 152,343,042 C96S probably damaging Het
Trim28 G A 7: 13,029,563 A544T probably benign Het
Trim56 A G 5: 137,112,778 V628A probably damaging Het
Ttc6 A G 12: 57,729,424 Y1718C probably damaging Het
Tuft1 T C 3: 94,622,138 Q244R probably benign Het
Unc13b A G 4: 43,240,321 T793A probably benign Het
Vmn1r39 A G 6: 66,804,596 I246T possibly damaging Het
Xpo1 T C 11: 23,282,646 S389P probably benign Het
Zdbf2 T C 1: 63,308,009 F1849S possibly damaging Het
Other mutations in Lgals8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01601:Lgals8 APN 13 12456338 splice site probably benign
IGL02407:Lgals8 APN 13 12454818 missense probably benign 0.01
R0015:Lgals8 UTSW 13 12447298 missense probably damaging 1.00
R0015:Lgals8 UTSW 13 12447298 missense probably damaging 1.00
R0973:Lgals8 UTSW 13 12451395 splice site probably benign
R1452:Lgals8 UTSW 13 12453327 nonsense probably null
R1748:Lgals8 UTSW 13 12454943 missense probably damaging 1.00
R1939:Lgals8 UTSW 13 12459188 missense probably benign 0.00
R2076:Lgals8 UTSW 13 12454869 nonsense probably null
R2214:Lgals8 UTSW 13 12454832 missense probably benign 0.02
R4568:Lgals8 UTSW 13 12453373 missense probably damaging 1.00
R4791:Lgals8 UTSW 13 12453322 missense possibly damaging 0.94
R5243:Lgals8 UTSW 13 12454764 missense probably benign 0.27
R6947:Lgals8 UTSW 13 12454801 start gained probably benign
R7476:Lgals8 UTSW 13 12448481 missense probably damaging 0.97
R7515:Lgals8 UTSW 13 12448462 nonsense probably null
R7942:Lgals8 UTSW 13 12453256 critical splice donor site probably null
R8208:Lgals8 UTSW 13 12453374 missense probably damaging 1.00
R8674:Lgals8 UTSW 13 12447236 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCAGTAGACTCGGAGATGGC -3'
(R):5'- GGCTCTGTTACTGAGGAAGAAG -3'

Sequencing Primer
(F):5'- ACTCGGAGATGGCCCCATG -3'
(R):5'- CTCTGTTACTGAGGAAGAAGAAAGG -3'
Posted On 2022-02-07