Incidental Mutation 'R9236:Pop1'
ID 700506
Institutional Source Beutler Lab
Gene Symbol Pop1
Ensembl Gene ENSMUSG00000022325
Gene Name processing of precursor 1, ribonuclease P/MRP family, (S. cerevisiae)
Synonyms 4932434G09Rik
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.960) question?
Stock # R9236 (G1)
Quality Score 225.009
Status Not validated
Chromosome 15
Chromosomal Location 34495304-34530648 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) C to A at 34499412 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Proline to Glutamine at position 41 (P41Q)
Ref Sequence ENSEMBL: ENSMUSP00000052654 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022946] [ENSMUST00000052290] [ENSMUST00000079028]
AlphaFold Q8K205
Predicted Effect probably benign
Transcript: ENSMUST00000022946
SMART Domains Protein: ENSMUSP00000022946
Gene: ENSMUSG00000022323

DomainStartEndE-ValueType
Pfam:Ribonuc_L-PSP 11 129 1.7e-46 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000052290
AA Change: P41Q

PolyPhen 2 Score 0.983 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000052654
Gene: ENSMUSG00000022325
AA Change: P41Q

DomainStartEndE-ValueType
Pfam:POP1 107 190 6.2e-21 PFAM
Pfam:POP1 179 257 2.5e-23 PFAM
low complexity region 382 387 N/A INTRINSIC
Pfam:POPLD 647 738 1.4e-30 PFAM
low complexity region 931 940 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000079028
AA Change: P41Q

PolyPhen 2 Score 0.983 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000078037
Gene: ENSMUSG00000022325
AA Change: P41Q

DomainStartEndE-ValueType
Pfam:POP1 107 258 1e-46 PFAM
low complexity region 382 387 N/A INTRINSIC
Pfam:POPLD 617 708 1.2e-34 PFAM
low complexity region 901 910 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the protein subunit of two different small nucleolar ribonucleoprotein complexes: the endoribonuclease for mitochondrial RNA processing complex and the ribonuclease P complex. The encoded protein is a ribonuclease that localizes to the nucleus and functions in pre-RNA processing. This protein is also an autoantigen in patients suffering from connective tissue diseases. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Mar 2009]
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca3 A G 17: 24,407,738 T1514A probably benign Het
Abcb1b G A 5: 8,824,893 probably null Het
Adam12 A C 7: 134,012,293 L109R probably benign Het
Adgre1 T A 17: 57,402,782 Y146* probably null Het
Ap5m1 G T 14: 49,073,607 V45L probably benign Het
Bpifa5 A T 2: 154,164,230 I113F probably damaging Het
Cacna1h A T 17: 25,381,450 M1639K probably damaging Het
Celsr1 T C 15: 86,030,850 E974G probably damaging Het
Cggbp1 C T 16: 64,855,955 A128V probably benign Het
Col7a1 G T 9: 108,960,616 R898L unknown Het
Cycs C T 6: 50,566,527 probably benign Het
Cyp2c54 A T 19: 40,072,494 Y68* probably null Het
Dock9 T C 14: 121,639,558 D467G probably damaging Het
Eif2s1 A T 12: 78,874,569 I83L probably benign Het
Eppk1 T A 15: 76,106,310 R2124* probably null Het
Fkbp15 G C 4: 62,336,427 L279V probably damaging Het
Fndc1 A G 17: 7,773,628 V412A unknown Het
Gfap A G 11: 102,895,501 I194T probably damaging Het
Gpatch2 C A 1: 187,233,780 T350K probably benign Het
Hecw1 C T 13: 14,316,058 G783D possibly damaging Het
Hipk1 A T 3: 103,764,473 W437R probably damaging Het
Hps4 G A 5: 112,378,039 S642N possibly damaging Het
Hr C T 14: 70,571,956 P1136S probably damaging Het
Il1rl2 T A 1: 40,329,061 N130K probably damaging Het
Kif13b A G 14: 64,744,934 I532V probably benign Het
Klk15 C T 7: 43,938,366 H73Y possibly damaging Het
Lrba T A 3: 86,353,759 I1474K probably benign Het
Luc7l3 T C 11: 94,295,946 E371G unknown Het
Myo5b T A 18: 74,720,863 D1184E probably benign Het
N4bp2l2 A G 5: 150,662,014 M167T probably benign Het
N4bp2l2 T C 5: 150,662,269 H82R probably benign Het
Ndufaf1 T C 2: 119,660,231 E118G possibly damaging Het
Nedd9 A T 13: 41,338,677 V119E possibly damaging Het
Nlgn3 T C X: 101,308,784 V179A probably damaging Het
Ntmt1 T A 2: 30,822,395 L150Q probably damaging Het
Olfr1097 C T 2: 86,890,278 S299N probably benign Het
Olfr1451 G T 19: 12,999,399 V138F probably damaging Het
Olfr836 A G 9: 19,121,910 *315W probably null Het
Olfr889 A T 9: 38,116,200 M140L possibly damaging Het
Osbpl8 A G 10: 111,270,635 N301S probably benign Het
Pgm5 A T 19: 24,861,639 S51T probably benign Het
Pitx2 A G 3: 129,215,696 K88R probably damaging Het
Pnmal2 A T 7: 16,946,039 D316V unknown Het
Rcor1 A C 12: 111,103,646 K292N Het
Rps6kc1 C T 1: 190,800,003 D601N probably damaging Het
Sema7a A T 9: 57,955,125 I204F probably damaging Het
Slc29a4 T C 5: 142,712,947 L121P probably damaging Het
Slc4a2 A G 5: 24,439,310 T983A probably benign Het
Slc4a4 C T 5: 89,046,299 R213* probably null Het
Tbc1d2 G A 4: 46,609,029 T736I probably benign Het
Tmco1 C T 1: 167,308,563 probably benign Het
Trim28 G A 7: 13,029,563 A544T probably benign Het
Trip12 A C 1: 84,725,829 L1895R probably damaging Het
Ttc41 A T 10: 86,776,730 Y1289F probably damaging Het
Vmn1r70 G A 7: 10,634,089 C168Y probably damaging Het
Vtcn1 C A 3: 100,888,217 R167S probably benign Het
Wdr66 T C 5: 123,290,062 C980R probably damaging Het
Zfp369 G A 13: 65,297,196 V718I probably benign Het
Zfp608 T C 18: 54,899,282 T529A probably benign Het
Zfp936 A G 7: 43,187,498 N46D probably benign Het
Zfp974 A G 7: 27,910,917 V461A possibly damaging Het
Zgrf1 A G 3: 127,584,663 N1024S probably benign Het
Other mutations in Pop1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00848:Pop1 APN 15 34508729 missense probably benign 0.00
IGL02192:Pop1 APN 15 34529071 missense probably benign 0.08
IGL02680:Pop1 APN 15 34502473 missense probably damaging 0.99
IGL02958:Pop1 APN 15 34530363 missense probably damaging 0.99
H8562:Pop1 UTSW 15 34530212 missense probably benign 0.00
PIT4802001:Pop1 UTSW 15 34529083 missense probably benign 0.00
R0244:Pop1 UTSW 15 34515891 nonsense probably null
R0281:Pop1 UTSW 15 34529858 splice site probably null
R0453:Pop1 UTSW 15 34526206 missense possibly damaging 0.82
R0579:Pop1 UTSW 15 34509969 missense possibly damaging 0.68
R1054:Pop1 UTSW 15 34509809 missense probably benign 0.30
R1501:Pop1 UTSW 15 34510357 missense probably benign 0.01
R1614:Pop1 UTSW 15 34530210 missense possibly damaging 0.46
R1994:Pop1 UTSW 15 34530471 missense probably damaging 1.00
R2084:Pop1 UTSW 15 34508598 splice site probably benign
R4020:Pop1 UTSW 15 34508780 missense probably benign 0.01
R4550:Pop1 UTSW 15 34528936 missense probably damaging 1.00
R4579:Pop1 UTSW 15 34515824 intron probably benign
R5672:Pop1 UTSW 15 34530179 missense possibly damaging 0.63
R6139:Pop1 UTSW 15 34529058 missense probably benign 0.26
R6161:Pop1 UTSW 15 34526310 missense probably damaging 1.00
R6821:Pop1 UTSW 15 34508639 missense possibly damaging 0.86
R7053:Pop1 UTSW 15 34530275 missense probably benign 0.01
R7195:Pop1 UTSW 15 34510379 missense probably damaging 0.97
R7543:Pop1 UTSW 15 34530447 missense probably damaging 1.00
R7571:Pop1 UTSW 15 34528947 missense probably null 1.00
R7587:Pop1 UTSW 15 34502413 missense probably damaging 0.97
R8401:Pop1 UTSW 15 34508609 missense probably damaging 1.00
R8406:Pop1 UTSW 15 34529170 missense probably benign
R8707:Pop1 UTSW 15 34529203 missense probably benign 0.02
R9044:Pop1 UTSW 15 34530408 missense possibly damaging 0.94
R9066:Pop1 UTSW 15 34515914 missense possibly damaging 0.68
RF001:Pop1 UTSW 15 34502437 missense probably damaging 1.00
RF002:Pop1 UTSW 15 34502437 missense probably damaging 1.00
Z1088:Pop1 UTSW 15 34499319 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGGATTCCTGCTATAGATTAATATGGT -3'
(R):5'- CAAGAAGGCAGACTTGTAAGC -3'

Sequencing Primer
(F):5'- CCTGGAACTTACTTTGTAGACCAGG -3'
(R):5'- GGCAGACTTGTAAGCACAAATTCTG -3'
Posted On 2022-02-07