Mutagenetix > Incidental Mutation

Incidental Mutation 'R9236:Trip12'

700458

Institutional Source

Beutler Lab

Gene Symbol

Trip12

Ensembl Gene

ENSMUSG00000026219

Gene Name

thyroid hormone receptor interactor 12

Synonyms

6720416K24Rik, 1110036I07Rik, Gtl6

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R9236 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

84721189-84840516 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to C at 84725829 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Leucine to Arginine at position 1895 (L1895R)

Ref Sequence

ENSEMBL: ENSMUSP00000027421 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000027421] [ENSMUST00000186465] [ENSMUST00000186648] [ENSMUST00000187733] [ENSMUST00000189670]

AlphaFold

G5E870

Predicted Effect

probably damaging
Transcript: ENSMUST00000027421
AA Change: L1895R

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000027421
Gene: ENSMUSG00000026219
AA Change: L1895R

Domain	Start	End	E-Value	Type
low complexity region	34	39	N/A	INTRINSIC
low complexity region	153	172	N/A	INTRINSIC
low complexity region	177	188	N/A	INTRINSIC
low complexity region	191	215	N/A	INTRINSIC
low complexity region	231	247	N/A	INTRINSIC
low complexity region	379	391	N/A	INTRINSIC
low complexity region	392	406	N/A	INTRINSIC
low complexity region	416	427	N/A	INTRINSIC
SCOP:d1ee4a_	446	660	5e-20	SMART
PDB:1WA5\|B	447	641	1e-5	PDB
Pfam:WWE	765	831	7.6e-22	PFAM
low complexity region	983	1006	N/A	INTRINSIC
low complexity region	1033	1047	N/A	INTRINSIC
low complexity region	1062	1073	N/A	INTRINSIC
low complexity region	1333	1344	N/A	INTRINSIC
low complexity region	1345	1362	N/A	INTRINSIC
Blast:HECTc	1363	1417	8e-8	BLAST
Blast:HECTc	1573	1629	2e-24	BLAST
HECTc	1636	2025	1.29e-177	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000186465
AA Change: L1895R

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000140224
Gene: ENSMUSG00000026219
AA Change: L1895R

Domain	Start	End	E-Value	Type
low complexity region	34	39	N/A	INTRINSIC
low complexity region	153	172	N/A	INTRINSIC
low complexity region	177	188	N/A	INTRINSIC
low complexity region	191	215	N/A	INTRINSIC
low complexity region	231	247	N/A	INTRINSIC
low complexity region	379	391	N/A	INTRINSIC
low complexity region	392	406	N/A	INTRINSIC
low complexity region	416	427	N/A	INTRINSIC
SCOP:d1ee4a_	446	660	5e-20	SMART
PDB:1WA5\|B	447	641	1e-5	PDB
Pfam:WWE	761	831	2.2e-22	PFAM
low complexity region	983	1006	N/A	INTRINSIC
low complexity region	1033	1047	N/A	INTRINSIC
low complexity region	1062	1073	N/A	INTRINSIC
low complexity region	1333	1344	N/A	INTRINSIC
low complexity region	1345	1362	N/A	INTRINSIC
Blast:HECTc	1363	1417	8e-8	BLAST
Blast:HECTc	1573	1629	2e-24	BLAST
HECTc	1636	2025	1.29e-177	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000186648
AA Change: L1862R

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000139563
Gene: ENSMUSG00000026219
AA Change: L1862R

Domain	Start	End	E-Value	Type
low complexity region	34	39	N/A	INTRINSIC
low complexity region	153	172	N/A	INTRINSIC
low complexity region	177	188	N/A	INTRINSIC
low complexity region	191	215	N/A	INTRINSIC
low complexity region	231	247	N/A	INTRINSIC
low complexity region	386	400	N/A	INTRINSIC
low complexity region	410	421	N/A	INTRINSIC
SCOP:d1ee4a_	440	654	5e-20	SMART
PDB:1WA5\|B	441	635	1e-5	PDB
low complexity region	950	973	N/A	INTRINSIC
low complexity region	1000	1014	N/A	INTRINSIC
low complexity region	1029	1040	N/A	INTRINSIC
low complexity region	1300	1311	N/A	INTRINSIC
low complexity region	1312	1329	N/A	INTRINSIC
Blast:HECTc	1330	1384	7e-8	BLAST
Blast:HECTc	1540	1596	2e-24	BLAST
HECTc	1603	1992	6.2e-180	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000187733

Predicted Effect

probably damaging
Transcript: ENSMUST00000189670
AA Change: L700R

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)

SMART Domains

Protein: ENSMUSP00000140789
Gene: ENSMUSG00000026219
AA Change: L700R

Domain	Start	End	E-Value	Type
low complexity region	138	149	N/A	INTRINSIC
low complexity region	150	167	N/A	INTRINSIC
Blast:HECTc	168	222	5e-8	BLAST
Blast:HECTc	378	434	1e-24	BLAST
HECTc	441	830	6.2e-180	SMART

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.7%
20x: 99.2%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is an E3 ubiquitin-protein ligase involved in the degradation of the p19ARF/ARF isoform of CDKN2A, a tumor suppressor. The encoded protein also plays a role in the DNA damage response by regulating the stability of USP7, which regulates tumor suppressor p53. [provided by RefSeq, Jan 2017]
PHENOTYPE: Mice homozygous for a targeted allele exhibit complete embryonic lethality during organogenesis associated with embryonic growth retardation and abnormal placenta development. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 62 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abca3	A	G	17: 24,407,738	T1514A	probably benign	Het
Abcb1b	G	A	5: 8,824,893		probably null	Het
Adam12	A	C	7: 134,012,293	L109R	probably benign	Het
Adgre1	T	A	17: 57,402,782	Y146*	probably null	Het
Ap5m1	G	T	14: 49,073,607	V45L	probably benign	Het
Bpifa5	A	T	2: 154,164,230	I113F	probably damaging	Het
Cacna1h	A	T	17: 25,381,450	M1639K	probably damaging	Het
Celsr1	T	C	15: 86,030,850	E974G	probably damaging	Het
Cggbp1	C	T	16: 64,855,955	A128V	probably benign	Het
Col7a1	G	T	9: 108,960,616	R898L	unknown	Het
Cycs	C	T	6: 50,566,527		probably benign	Het
Cyp2c54	A	T	19: 40,072,494	Y68*	probably null	Het
Dock9	T	C	14: 121,639,558	D467G	probably damaging	Het
Eif2s1	A	T	12: 78,874,569	I83L	probably benign	Het
Eppk1	T	A	15: 76,106,310	R2124*	probably null	Het
Fkbp15	G	C	4: 62,336,427	L279V	probably damaging	Het
Fndc1	A	G	17: 7,773,628	V412A	unknown	Het
Gfap	A	G	11: 102,895,501	I194T	probably damaging	Het
Gpatch2	C	A	1: 187,233,780	T350K	probably benign	Het
Hecw1	C	T	13: 14,316,058	G783D	possibly damaging	Het
Hipk1	A	T	3: 103,764,473	W437R	probably damaging	Het
Hps4	G	A	5: 112,378,039	S642N	possibly damaging	Het
Hr	C	T	14: 70,571,956	P1136S	probably damaging	Het
Il1rl2	T	A	1: 40,329,061	N130K	probably damaging	Het
Kif13b	A	G	14: 64,744,934	I532V	probably benign	Het
Klk15	C	T	7: 43,938,366	H73Y	possibly damaging	Het
Lrba	T	A	3: 86,353,759	I1474K	probably benign	Het
Luc7l3	T	C	11: 94,295,946	E371G	unknown	Het
Myo5b	T	A	18: 74,720,863	D1184E	probably benign	Het
N4bp2l2	A	G	5: 150,662,014	M167T	probably benign	Het
N4bp2l2	T	C	5: 150,662,269	H82R	probably benign	Het
Ndufaf1	T	C	2: 119,660,231	E118G	possibly damaging	Het
Nedd9	A	T	13: 41,338,677	V119E	possibly damaging	Het
Nlgn3	T	C	X: 101,308,784	V179A	probably damaging	Het
Ntmt1	T	A	2: 30,822,395	L150Q	probably damaging	Het
Olfr1097	C	T	2: 86,890,278	S299N	probably benign	Het
Olfr1451	G	T	19: 12,999,399	V138F	probably damaging	Het
Olfr836	A	G	9: 19,121,910	*315W	probably null	Het
Olfr889	A	T	9: 38,116,200	M140L	possibly damaging	Het
Osbpl8	A	G	10: 111,270,635	N301S	probably benign	Het
Pgm5	A	T	19: 24,861,639	S51T	probably benign	Het
Pitx2	A	G	3: 129,215,696	K88R	probably damaging	Het
Pnmal2	A	T	7: 16,946,039	D316V	unknown	Het
Pop1	C	A	15: 34,499,412	P41Q	probably damaging	Het
Rcor1	A	C	12: 111,103,646	K292N		Het
Rps6kc1	C	T	1: 190,800,003	D601N	probably damaging	Het
Sema7a	A	T	9: 57,955,125	I204F	probably damaging	Het
Slc29a4	T	C	5: 142,712,947	L121P	probably damaging	Het
Slc4a2	A	G	5: 24,439,310	T983A	probably benign	Het
Slc4a4	C	T	5: 89,046,299	R213*	probably null	Het
Tbc1d2	G	A	4: 46,609,029	T736I	probably benign	Het
Tmco1	C	T	1: 167,308,563		probably benign	Het
Trim28	G	A	7: 13,029,563	A544T	probably benign	Het
Ttc41	A	T	10: 86,776,730	Y1289F	probably damaging	Het
Vmn1r70	G	A	7: 10,634,089	C168Y	probably damaging	Het
Vtcn1	C	A	3: 100,888,217	R167S	probably benign	Het
Wdr66	T	C	5: 123,290,062	C980R	probably damaging	Het
Zfp369	G	A	13: 65,297,196	V718I	probably benign	Het
Zfp608	T	C	18: 54,899,282	T529A	probably benign	Het
Zfp936	A	G	7: 43,187,498	N46D	probably benign	Het
Zfp974	A	G	7: 27,910,917	V461A	possibly damaging	Het
Zgrf1	A	G	3: 127,584,663	N1024S	probably benign	Het

Other mutations in Trip12

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00331:Trip12	APN	1	84730541	missense	probably damaging	1.00
IGL00430:Trip12	APN	1	84763861	missense	probably damaging	0.96
IGL00465:Trip12	APN	1	84763861	missense	probably damaging	0.96
IGL00819:Trip12	APN	1	84754272	missense	probably damaging	1.00
IGL00900:Trip12	APN	1	84724764	missense	possibly damaging	0.56
IGL00990:Trip12	APN	1	84751884	missense	probably damaging	0.99
IGL01087:Trip12	APN	1	84757859	missense	probably damaging	0.99
IGL01400:Trip12	APN	1	84751978	missense	probably damaging	0.99
IGL01521:Trip12	APN	1	84766198	splice site	probably benign
IGL01619:Trip12	APN	1	84814910	missense	probably damaging	0.99
IGL01796:Trip12	APN	1	84728278	missense	probably benign	0.42
IGL01975:Trip12	APN	1	84814813	splice site	probably benign
IGL02190:Trip12	APN	1	84766070	missense	probably damaging	0.98
IGL02474:Trip12	APN	1	84794133	missense	probably benign
IGL02517:Trip12	APN	1	84743814	unclassified	probably benign
IGL02631:Trip12	APN	1	84766008	missense	possibly damaging	0.91
IGL02991:Trip12	APN	1	84738815	missense	probably damaging	1.00
IGL03161:Trip12	APN	1	84761132	unclassified	probably benign
IGL03388:Trip12	APN	1	84743186	missense	probably damaging	0.99
cardamom	UTSW	1	84749276	missense	probably damaging	0.99
pungent	UTSW	1	84793915	missense	possibly damaging	0.70
spices	UTSW	1	84793875	missense	probably benign	0.10
sulfuric	UTSW	1	84759050	missense	probably benign	0.19
Turmeric	UTSW	1	84754343	missense	probably benign	0.07
LCD18:Trip12	UTSW	1	84754482	unclassified	probably benign
R0090:Trip12	UTSW	1	84732136	splice site	probably benign
R0111:Trip12	UTSW	1	84759133	unclassified	probably benign
R0471:Trip12	UTSW	1	84726207	missense	probably damaging	1.00
R0486:Trip12	UTSW	1	84761084	nonsense	probably null
R0557:Trip12	UTSW	1	84724747	missense	probably damaging	1.00
R0570:Trip12	UTSW	1	84751548	missense	probably damaging	1.00
R0614:Trip12	UTSW	1	84757761	missense	probably damaging	1.00
R0627:Trip12	UTSW	1	84768597	missense	probably damaging	1.00
R0630:Trip12	UTSW	1	84793915	missense	possibly damaging	0.70
R0657:Trip12	UTSW	1	84759050	missense	probably benign	0.19
R0741:Trip12	UTSW	1	84745181	missense	probably benign	0.09
R0862:Trip12	UTSW	1	84744009	missense	probably damaging	0.99
R0864:Trip12	UTSW	1	84744009	missense	probably damaging	0.99
R1124:Trip12	UTSW	1	84737037	missense	probably damaging	1.00
R1252:Trip12	UTSW	1	84776350	nonsense	probably null
R1455:Trip12	UTSW	1	84759100	missense	probably benign	0.01
R1487:Trip12	UTSW	1	84768631	missense	probably damaging	1.00
R1702:Trip12	UTSW	1	84745063	missense	probably damaging	1.00
R1781:Trip12	UTSW	1	84730621	missense	probably benign	0.01
R1847:Trip12	UTSW	1	84749269	missense	probably damaging	1.00
R1854:Trip12	UTSW	1	84728145	missense	probably damaging	1.00
R1866:Trip12	UTSW	1	84745060	missense	probably damaging	1.00
R1926:Trip12	UTSW	1	84749291	missense	probably damaging	0.98
R1935:Trip12	UTSW	1	84794101	missense	possibly damaging	0.46
R1950:Trip12	UTSW	1	84760801	missense	probably damaging	1.00
R1994:Trip12	UTSW	1	84749172	missense	probably damaging	1.00
R2014:Trip12	UTSW	1	84760866	nonsense	probably null
R2391:Trip12	UTSW	1	84814790	frame shift	probably null
R2423:Trip12	UTSW	1	84814790	frame shift	probably null
R2433:Trip12	UTSW	1	84743823	missense	possibly damaging	0.84
R2905:Trip12	UTSW	1	84754343	missense	probably benign	0.07
R3040:Trip12	UTSW	1	84742245	missense	probably benign	0.13
R3735:Trip12	UTSW	1	84814790	frame shift	probably null
R3907:Trip12	UTSW	1	84732106	missense	possibly damaging	0.53
R4394:Trip12	UTSW	1	84725741	missense	probably damaging	1.00
R4540:Trip12	UTSW	1	84749276	missense	probably damaging	0.99
R4859:Trip12	UTSW	1	84793810	missense	probably damaging	0.99
R5240:Trip12	UTSW	1	84794133	missense	probably benign
R5278:Trip12	UTSW	1	84762147	missense	probably damaging	1.00
R5377:Trip12	UTSW	1	84757431	missense	probably damaging	1.00
R5510:Trip12	UTSW	1	84768680	missense	probably damaging	1.00
R5542:Trip12	UTSW	1	84749344	missense	probably damaging	1.00
R5550:Trip12	UTSW	1	84761099	missense	probably damaging	0.99
R5886:Trip12	UTSW	1	84730458	intron	probably benign
R5893:Trip12	UTSW	1	84759163	unclassified	probably benign
R5914:Trip12	UTSW	1	84763458	missense	probably damaging	1.00
R5925:Trip12	UTSW	1	84749253	nonsense	probably null
R5985:Trip12	UTSW	1	84725771	missense	probably damaging	0.99
R6135:Trip12	UTSW	1	84760838	missense	probably benign	0.00
R6158:Trip12	UTSW	1	84761012	missense	possibly damaging	0.84
R6419:Trip12	UTSW	1	84793870	missense	probably damaging	1.00
R6816:Trip12	UTSW	1	84793714	missense	probably damaging	0.99
R7144:Trip12	UTSW	1	84793714	missense	probably damaging	0.99
R7194:Trip12	UTSW	1	84794222	missense	probably benign	0.07
R7355:Trip12	UTSW	1	84814883	missense	probably damaging	1.00
R7361:Trip12	UTSW	1	84750442	missense	probably damaging	0.98
R7588:Trip12	UTSW	1	84760883	missense	probably damaging	0.99
R7705:Trip12	UTSW	1	84777449	missense	probably damaging	1.00
R7818:Trip12	UTSW	1	84760806	missense	probably damaging	1.00
R7918:Trip12	UTSW	1	84745063	missense	probably damaging	0.98
R8127:Trip12	UTSW	1	84738742	missense	probably damaging	0.99
R8221:Trip12	UTSW	1	84766050	missense	possibly damaging	0.80
R8336:Trip12	UTSW	1	84766041	missense	probably benign	0.37
R8373:Trip12	UTSW	1	84795767	missense	probably damaging	0.98
R8719:Trip12	UTSW	1	84745069	missense	probably damaging	0.98
R8771:Trip12	UTSW	1	84743297	unclassified	probably benign
R8997:Trip12	UTSW	1	84793875	missense	probably benign	0.10
R9146:Trip12	UTSW	1	84794160	missense	possibly damaging	0.89
R9338:Trip12	UTSW	1	84749298	missense	probably damaging	0.99
R9391:Trip12	UTSW	1	84795752	missense	probably benign	0.00
R9516:Trip12	UTSW	1	84757494	missense	probably damaging	1.00
X0023:Trip12	UTSW	1	84760787	missense	probably benign	0.12
X0065:Trip12	UTSW	1	84749163	missense	probably benign	0.21
Z1088:Trip12	UTSW	1	84766168	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- GCTGAAATCTAAAGGGAACAACTTC -3'
(R):5'- AGTTAGTTAAATGAGGGAGCAGTTC -3'

Sequencing Primer
(F):5'- TATAGCCATGATCAGGCC -3'
(R):5'- TCTTGTGTGAAGTAAAGTACAGAGC -3'

Posted On

2022-02-07