Incidental Mutation 'R9251:Fam171a1'
ID 701526
Institutional Source Beutler Lab
Gene Symbol Fam171a1
Ensembl Gene ENSMUSG00000050530
Gene Name family with sequence similarity 171, member A1
Synonyms
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.109) question?
Stock # R9251 (G1)
Quality Score 225.009
Status Validated
Chromosome 2
Chromosomal Location 3114224-3227806 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 3225488 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Serine to Proline at position 553 (S553P)
Ref Sequence ENSEMBL: ENSMUSP00000110751 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000062934] [ENSMUST00000072955] [ENSMUST00000091505] [ENSMUST00000115099]
AlphaFold A2ATK9
Predicted Effect probably benign
Transcript: ENSMUST00000062934
AA Change: S548P

PolyPhen 2 Score 0.060 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000053619
Gene: ENSMUSG00000050530
AA Change: S548P

DomainStartEndE-ValueType
Pfam:UPF0560 29 885 N/A PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000072955
AA Change: S428P

PolyPhen 2 Score 0.060 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000072724
Gene: ENSMUSG00000050530
AA Change: S428P

DomainStartEndE-ValueType
Pfam:UPF0560 1 765 N/A PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000091505
SMART Domains Protein: ENSMUSP00000089086
Gene: ENSMUSG00000050530

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
Pfam:UPF0560 34 294 3.1e-146 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000115099
AA Change: S553P

PolyPhen 2 Score 0.060 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000110751
Gene: ENSMUSG00000050530
AA Change: S553P

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
Pfam:UPF0560 34 890 N/A PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency 100% (59/59)
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Arhgap31 G T 16: 38,602,856 N949K probably benign Het
Arv1 T A 8: 124,725,323 I76N probably damaging Het
Cfap44 G A 16: 44,408,913 A189T probably damaging Het
Ch25h T C 19: 34,474,369 Y253C probably damaging Het
Cnot11 T C 1: 39,542,506 M376T probably damaging Het
Cnot7 T C 8: 40,511,581 probably benign Het
Dnah17 G A 11: 118,121,792 S481F probably benign Het
Dnah2 C T 11: 69,515,793 R541Q probably damaging Het
Dnah7a C T 1: 53,582,512 M1151I probably damaging Het
Dpf2 T C 19: 5,907,138 D19G probably damaging Het
Eefsec A T 6: 88,355,592 M212K probably damaging Het
Elp6 G A 9: 110,305,598 V12I unknown Het
Enox1 G A 14: 77,615,557 probably null Het
Epha1 G T 6: 42,364,843 N424K probably damaging Het
Fbxw21 A G 9: 109,145,619 S278P probably damaging Het
Gm45861 T C 8: 27,542,561 probably null Het
Gm4846 T A 1: 166,483,738 R517S probably benign Het
Gnrhr A G 5: 86,197,362 L155P possibly damaging Het
Igfn1 C T 1: 135,966,671 probably benign Het
Ik T A 18: 36,747,442 probably null Het
Insrr A T 3: 87,810,084 Q763L probably benign Het
Klf5 G T 14: 99,301,388 C79F possibly damaging Het
Lrrcc1 A T 3: 14,558,394 R760S probably damaging Het
Map3k7 T A 4: 32,002,080 probably benign Het
Mapkbp1 C T 2: 120,023,190 A1159V probably benign Het
Mgst3 C T 1: 167,378,291 probably null Het
Mtch2 T A 2: 90,849,636 F71I probably damaging Het
Myo1e A G 9: 70,368,794 I764V probably benign Het
Myo3b T A 2: 70,258,081 L896* probably null Het
Ndufs5 T G 4: 123,712,835 E103A probably benign Het
Nfe2l1 G A 11: 96,819,595 P603S probably damaging Het
Olfr801 T A 10: 129,670,111 N136I possibly damaging Het
Olfr954 A T 9: 39,462,372 M311L probably benign Het
Piezo1 T C 8: 122,492,615 N1093S Het
Pitpnb G A 5: 111,385,524 R258H probably benign Het
Pla2g4d T C 2: 120,268,897 E708G possibly damaging Het
Plppr4 T A 3: 117,321,959 T750S probably benign Het
Prrg4 T G 2: 104,845,054 E68A probably damaging Het
Rcan2 C T 17: 44,017,810 T90M possibly damaging Het
Rlbp1 T C 7: 79,377,345 E189G probably damaging Het
Satb1 A G 17: 51,805,265 F107S probably damaging Het
Sdc3 A T 4: 130,821,202 probably benign Het
Slc22a3 A T 17: 12,507,206 V40D probably damaging Het
Slc35d1 A G 4: 103,190,830 probably null Het
Slfn1 T C 11: 83,121,295 F79S probably damaging Het
Snrpg G T 6: 86,376,575 V46L probably benign Het
Tbl1xr1 G A 3: 22,210,405 C508Y probably benign Het
Thada A T 17: 84,231,136 D1481E probably benign Het
Tnfsf8 A G 4: 63,860,980 V27A probably benign Het
Tns1 T C 1: 73,991,696 H300R probably damaging Het
Ttc13 C A 8: 124,675,253 G589V probably benign Het
Ttc28 A G 5: 110,892,832 I29V possibly damaging Het
Tubb4a T A 17: 57,080,778 N416I possibly damaging Het
Ubr4 T A 4: 139,450,325 I1884N Het
Usp16 A G 16: 87,469,752 K175E probably benign Het
Usp24 A G 4: 106,360,518 I479M probably benign Het
Utrn T C 10: 12,636,787 T2313A probably benign Het
Ythdc2 T C 18: 44,841,375 V368A probably benign Het
Zfp628 T C 7: 4,920,881 S701P probably damaging Het
Other mutations in Fam171a1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00953:Fam171a1 APN 2 3178290 missense possibly damaging 0.90
IGL01138:Fam171a1 APN 2 3202620 missense possibly damaging 0.80
IGL01317:Fam171a1 APN 2 3202626 missense probably damaging 1.00
IGL02377:Fam171a1 APN 2 3223586 critical splice donor site probably null
IGL02475:Fam171a1 APN 2 3223490 missense possibly damaging 0.53
IGL02477:Fam171a1 APN 2 3202575 missense possibly damaging 0.83
ghosted UTSW 2 3225152 nonsense probably null
R0167:Fam171a1 UTSW 2 3186432 missense probably damaging 1.00
R0426:Fam171a1 UTSW 2 3225396 missense probably benign
R0468:Fam171a1 UTSW 2 3225396 missense probably benign
R0811:Fam171a1 UTSW 2 3197427 missense probably damaging 1.00
R0812:Fam171a1 UTSW 2 3197427 missense probably damaging 1.00
R1099:Fam171a1 UTSW 2 3225317 missense probably benign 0.24
R1694:Fam171a1 UTSW 2 3225623 missense probably benign 0.00
R1817:Fam171a1 UTSW 2 3178373 missense probably benign 0.04
R1869:Fam171a1 UTSW 2 3226152 missense possibly damaging 0.53
R1887:Fam171a1 UTSW 2 3220343 missense probably damaging 1.00
R2173:Fam171a1 UTSW 2 3225619 nonsense probably null
R2355:Fam171a1 UTSW 2 3225533 nonsense probably null
R3690:Fam171a1 UTSW 2 3226356 missense probably benign
R3723:Fam171a1 UTSW 2 3220375 splice site probably benign
R3978:Fam171a1 UTSW 2 3225035 missense probably benign
R4087:Fam171a1 UTSW 2 3226296 missense probably damaging 0.97
R4647:Fam171a1 UTSW 2 3220291 missense probably damaging 0.98
R4744:Fam171a1 UTSW 2 3224909 missense probably damaging 1.00
R4777:Fam171a1 UTSW 2 3223513 missense probably benign 0.03
R4786:Fam171a1 UTSW 2 3225578 missense probably damaging 1.00
R4888:Fam171a1 UTSW 2 3223509 missense probably damaging 0.98
R4982:Fam171a1 UTSW 2 3178468 splice site probably null
R5137:Fam171a1 UTSW 2 3225389 missense probably benign 0.01
R5203:Fam171a1 UTSW 2 3223545 missense probably damaging 0.99
R5233:Fam171a1 UTSW 2 3178353 missense probably damaging 1.00
R5304:Fam171a1 UTSW 2 3225617 missense probably damaging 1.00
R5475:Fam171a1 UTSW 2 3225297 missense possibly damaging 0.91
R5682:Fam171a1 UTSW 2 3226089 missense probably damaging 1.00
R5865:Fam171a1 UTSW 2 3225337 missense probably benign 0.01
R6322:Fam171a1 UTSW 2 3226355 missense probably benign 0.24
R7082:Fam171a1 UTSW 2 3223475 missense probably benign 0.00
R7141:Fam171a1 UTSW 2 3225152 nonsense probably null
R7155:Fam171a1 UTSW 2 3225729 missense probably benign 0.10
R7243:Fam171a1 UTSW 2 3118616 missense probably benign 0.07
R7326:Fam171a1 UTSW 2 3226472 nonsense probably null
R7477:Fam171a1 UTSW 2 3225639 missense probably benign 0.03
R7574:Fam171a1 UTSW 2 3220354 missense probably damaging 1.00
R7745:Fam171a1 UTSW 2 3225446 missense possibly damaging 0.53
R7753:Fam171a1 UTSW 2 3178317 missense probably damaging 0.98
R7871:Fam171a1 UTSW 2 3225384 missense probably benign 0.12
R7958:Fam171a1 UTSW 2 3178261 missense probably damaging 1.00
R8677:Fam171a1 UTSW 2 3220315 missense probably damaging 0.98
R8793:Fam171a1 UTSW 2 3186498 missense probably damaging 1.00
R8850:Fam171a1 UTSW 2 3220307 missense probably damaging 1.00
R8865:Fam171a1 UTSW 2 3225903 missense probably damaging 1.00
R9016:Fam171a1 UTSW 2 3226397 missense probably benign 0.43
R9090:Fam171a1 UTSW 2 3223506 missense probably damaging 1.00
R9271:Fam171a1 UTSW 2 3223506 missense probably damaging 1.00
R9350:Fam171a1 UTSW 2 3225000 missense probably benign 0.12
X0019:Fam171a1 UTSW 2 3225593 missense probably benign 0.19
Z1177:Fam171a1 UTSW 2 3224934 missense possibly damaging 0.82
Predicted Primers PCR Primer
(F):5'- CTGGCAATGATGACTACAGAGG -3'
(R):5'- GGAGCCTTCCTATTTCCAGCTG -3'

Sequencing Primer
(F):5'- GAGGTAGTTACAATACCGTGCTCTC -3'
(R):5'- GGCAGGCAATACTTTCCT -3'
Posted On 2022-03-25