Incidental Mutation 'R8850:Fam171a1'
ID 674919
Institutional Source Beutler Lab
Gene Symbol Fam171a1
Ensembl Gene ENSMUSG00000050530
Gene Name family with sequence similarity 171, member A1
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.109) question?
Stock # R8850 (G1)
Quality Score 225.009
Status Validated
Chromosome 2
Chromosomal Location 3114224-3227806 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) C to T at 3220307 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Threonine to Methionine at position 270 (T270M)
Ref Sequence ENSEMBL: ENSMUSP00000110751 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000062934] [ENSMUST00000072955] [ENSMUST00000091505] [ENSMUST00000115099]
AlphaFold A2ATK9
Predicted Effect probably damaging
Transcript: ENSMUST00000062934
AA Change: T265M

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000053619
Gene: ENSMUSG00000050530
AA Change: T265M

DomainStartEndE-ValueType
Pfam:UPF0560 29 885 N/A PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000072955
AA Change: T145M

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000072724
Gene: ENSMUSG00000050530
AA Change: T145M

DomainStartEndE-ValueType
Pfam:UPF0560 1 765 N/A PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000091505
AA Change: T270M

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000089086
Gene: ENSMUSG00000050530
AA Change: T270M

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
Pfam:UPF0560 34 294 3.1e-146 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000115099
AA Change: T270M

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000110751
Gene: ENSMUSG00000050530
AA Change: T270M

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
Pfam:UPF0560 34 890 N/A PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 100% (64/64)
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Actr10 G A 12: 70,942,258 probably null Het
Adgrd1 A G 5: 129,142,510 K465E probably benign Het
Aktip A T 8: 91,126,774 V105E probably benign Het
Ankrd7 A G 6: 18,870,007 Y253C probably damaging Het
Bag6 T C 17: 35,142,065 M440T unknown Het
Camk2b T A 11: 5,972,838 N426Y probably damaging Het
Ccdc82 T A 9: 13,289,352 Y500* probably null Het
Cenpe T A 3: 135,225,016 D341E probably damaging Het
Cyp2j13 A T 4: 96,068,191 M227K probably benign Het
Dmbt1 G A 7: 131,090,404 V967I unknown Het
Dnmt3b A T 2: 153,674,013 N447Y probably benign Het
Dtl A T 1: 191,553,063 Y320* probably null Het
Dtymk A C 1: 93,801,821 S3A probably benign Het
Eefsec G A 6: 88,446,271 T70M possibly damaging Het
Gm17677 A G 9: 35,741,095 Y16C probably damaging Het
Gm17728 T C 17: 9,422,327 S90P probably benign Het
Hdlbp A G 1: 93,431,331 L213P probably damaging Het
Heatr5b T C 17: 78,801,759 I1024V probably benign Het
Hr C T 14: 70,561,865 R597* probably null Het
Ifit3 T C 19: 34,587,588 I178T probably damaging Het
Ifna6 A G 4: 88,827,985 *190W probably null Het
Igkv4-55 A T 6: 69,607,331 M99K probably benign Het
Klk1 T A 7: 44,227,632 I53N probably damaging Het
Lpcat2b A G 5: 107,432,826 H7R probably benign Het
Lrrc37a G A 11: 103,502,655 P648L Het
Mast4 G T 13: 102,758,666 P975H probably damaging Het
Mfrp C T 9: 44,102,510 L106F probably benign Het
Mllt10 T A 2: 18,196,658 S652T probably benign Het
Mroh8 C A 2: 157,241,753 G400W probably damaging Het
Neurl4 A G 11: 69,903,962 probably benign Het
Nop14 A C 5: 34,660,008 V13G probably benign Het
Nup188 T A 2: 30,327,564 L837Q probably damaging Het
Olfr1089 T C 2: 86,732,958 Y218C probably damaging Het
Olfr318 T A 11: 58,720,746 T101S probably benign Het
Olfr441 T A 6: 43,115,971 N76K possibly damaging Het
Olfr849 T C 9: 19,441,521 S203P probably damaging Het
Pde8b A T 13: 95,090,285 V185E probably benign Het
Pink1 G T 4: 138,320,022 A247D probably damaging Het
Pla2g10 A T 16: 13,728,050 V40D probably damaging Het
Plce1 G A 19: 38,524,367 G37R probably benign Het
Pld1 A G 3: 28,112,290 E826G possibly damaging Het
Poc5 G T 13: 96,398,720 K164N possibly damaging Het
Polr2b A T 5: 77,315,914 M53L probably benign Het
Ppp1r10 C T 17: 35,928,798 P470S probably damaging Het
Rasef A G 4: 73,727,603 S510P probably damaging Het
Rnf17 T A 14: 56,485,201 L1073Q probably damaging Het
Rpl13a-ps1 C T 19: 50,030,300 G146R probably damaging Het
Scn2a A G 2: 65,688,386 D368G probably damaging Het
Shc3 T A 13: 51,480,212 S86C probably benign Het
Sos1 T C 17: 80,433,976 H460R probably damaging Het
Steap1 T A 5: 5,740,838 M37L probably benign Het
Themis G T 10: 28,797,496 C593F possibly damaging Het
Tnn A G 1: 160,110,244 probably null Het
Trabd G T 15: 89,085,464 probably benign Het
Trim42 T A 9: 97,365,994 K216N probably damaging Het
Trmt44 G A 5: 35,564,329 P497S probably benign Het
Trp53bp2 A G 1: 182,428,910 Y15C probably damaging Het
Trpm7 T A 2: 126,810,180 I1458L probably benign Het
Ttc17 G T 2: 94,406,658 A3E possibly damaging Het
Ttn C A 2: 76,873,864 V9274L unknown Het
Vmn2r105 T A 17: 20,208,610 I735F probably damaging Het
Vmn2r22 A G 6: 123,637,495 C379R probably damaging Het
Vmn2r97 G A 17: 18,929,345 E332K probably benign Het
Xrn1 A G 9: 96,038,679 T1331A probably benign Het
Zcchc6 T A 13: 59,789,197 Q1212L possibly damaging Het
Other mutations in Fam171a1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00953:Fam171a1 APN 2 3178290 missense possibly damaging 0.90
IGL01138:Fam171a1 APN 2 3202620 missense possibly damaging 0.80
IGL01317:Fam171a1 APN 2 3202626 missense probably damaging 1.00
IGL02377:Fam171a1 APN 2 3223586 critical splice donor site probably null
IGL02475:Fam171a1 APN 2 3223490 missense possibly damaging 0.53
IGL02477:Fam171a1 APN 2 3202575 missense possibly damaging 0.83
ghosted UTSW 2 3225152 nonsense probably null
R0167:Fam171a1 UTSW 2 3186432 missense probably damaging 1.00
R0426:Fam171a1 UTSW 2 3225396 missense probably benign
R0468:Fam171a1 UTSW 2 3225396 missense probably benign
R0811:Fam171a1 UTSW 2 3197427 missense probably damaging 1.00
R0812:Fam171a1 UTSW 2 3197427 missense probably damaging 1.00
R1099:Fam171a1 UTSW 2 3225317 missense probably benign 0.24
R1694:Fam171a1 UTSW 2 3225623 missense probably benign 0.00
R1817:Fam171a1 UTSW 2 3178373 missense probably benign 0.04
R1869:Fam171a1 UTSW 2 3226152 missense possibly damaging 0.53
R1887:Fam171a1 UTSW 2 3220343 missense probably damaging 1.00
R2173:Fam171a1 UTSW 2 3225619 nonsense probably null
R2355:Fam171a1 UTSW 2 3225533 nonsense probably null
R3690:Fam171a1 UTSW 2 3226356 missense probably benign
R3723:Fam171a1 UTSW 2 3220375 splice site probably benign
R3978:Fam171a1 UTSW 2 3225035 missense probably benign
R4087:Fam171a1 UTSW 2 3226296 missense probably damaging 0.97
R4647:Fam171a1 UTSW 2 3220291 missense probably damaging 0.98
R4744:Fam171a1 UTSW 2 3224909 missense probably damaging 1.00
R4777:Fam171a1 UTSW 2 3223513 missense probably benign 0.03
R4786:Fam171a1 UTSW 2 3225578 missense probably damaging 1.00
R4888:Fam171a1 UTSW 2 3223509 missense probably damaging 0.98
R4982:Fam171a1 UTSW 2 3178468 splice site probably null
R5137:Fam171a1 UTSW 2 3225389 missense probably benign 0.01
R5203:Fam171a1 UTSW 2 3223545 missense probably damaging 0.99
R5233:Fam171a1 UTSW 2 3178353 missense probably damaging 1.00
R5304:Fam171a1 UTSW 2 3225617 missense probably damaging 1.00
R5475:Fam171a1 UTSW 2 3225297 missense possibly damaging 0.91
R5682:Fam171a1 UTSW 2 3226089 missense probably damaging 1.00
R5865:Fam171a1 UTSW 2 3225337 missense probably benign 0.01
R6322:Fam171a1 UTSW 2 3226355 missense probably benign 0.24
R7082:Fam171a1 UTSW 2 3223475 missense probably benign 0.00
R7141:Fam171a1 UTSW 2 3225152 nonsense probably null
R7155:Fam171a1 UTSW 2 3225729 missense probably benign 0.10
R7243:Fam171a1 UTSW 2 3118616 missense probably benign 0.07
R7326:Fam171a1 UTSW 2 3226472 nonsense probably null
R7477:Fam171a1 UTSW 2 3225639 missense probably benign 0.03
R7574:Fam171a1 UTSW 2 3220354 missense probably damaging 1.00
R7745:Fam171a1 UTSW 2 3225446 missense possibly damaging 0.53
R7753:Fam171a1 UTSW 2 3178317 missense probably damaging 0.98
R7871:Fam171a1 UTSW 2 3225384 missense probably benign 0.12
R7958:Fam171a1 UTSW 2 3178261 missense probably damaging 1.00
R8677:Fam171a1 UTSW 2 3220315 missense probably damaging 0.98
R8793:Fam171a1 UTSW 2 3186498 missense probably damaging 1.00
R8865:Fam171a1 UTSW 2 3225903 missense probably damaging 1.00
R9016:Fam171a1 UTSW 2 3226397 missense probably benign 0.43
R9090:Fam171a1 UTSW 2 3223506 missense probably damaging 1.00
R9251:Fam171a1 UTSW 2 3225488 missense probably benign 0.06
R9271:Fam171a1 UTSW 2 3223506 missense probably damaging 1.00
R9350:Fam171a1 UTSW 2 3225000 missense probably benign 0.12
X0019:Fam171a1 UTSW 2 3225593 missense probably benign 0.19
Z1177:Fam171a1 UTSW 2 3224934 missense possibly damaging 0.82
Predicted Primers PCR Primer
(F):5'- GGTAATGTGACTGACTGGGC -3'
(R):5'- CCTCCATGTCAAAGTTCCAGG -3'

Sequencing Primer
(F):5'- CTATCCAGCAAGTTGTGAATGCGAC -3'
(R):5'- AGGTACTGCTCTCCACTGAC -3'
Posted On 2021-07-15