Incidental Mutation 'R9275:Scn1a'
ID 703205
Institutional Source Beutler Lab
Gene Symbol Scn1a
Ensembl Gene ENSMUSG00000064329
Gene Name sodium channel, voltage-gated, type I, alpha
Synonyms Nav1.1
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R9275 (G1)
Quality Score 225.009
Status Not validated
Chromosome 2
Chromosomal Location 66270778-66440840 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to A at 66299682 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Phenylalanine at position 243 (Y243F)
Ref Sequence ENSEMBL: ENSMUSP00000144633 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000077489] [ENSMUST00000094951] [ENSMUST00000112366] [ENSMUST00000112371] [ENSMUST00000156865]
AlphaFold A2APX8
Predicted Effect possibly damaging
Transcript: ENSMUST00000077489
AA Change: Y1263F

PolyPhen 2 Score 0.891 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000076697
Gene: ENSMUSG00000064329
AA Change: Y1263F

DomainStartEndE-ValueType
low complexity region 23 52 N/A INTRINSIC
Pfam:Ion_trans 156 422 5.4e-77 PFAM
low complexity region 431 466 N/A INTRINSIC
Pfam:DUF3451 484 708 5.5e-73 PFAM
Pfam:Ion_trans 791 980 6.8e-47 PFAM
Pfam:Na_trans_assoc 995 1217 1.2e-74 PFAM
Pfam:Ion_trans 1243 1471 1.1e-56 PFAM
PDB:1BYY|A 1473 1525 4e-31 PDB
Pfam:Ion_trans 1564 1774 1.1e-51 PFAM
Pfam:PKD_channel 1623 1781 3.9e-7 PFAM
low complexity region 1826 1838 N/A INTRINSIC
IQ 1903 1925 1.65e-2 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000094951
AA Change: Y1246F

PolyPhen 2 Score 0.989 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000092558
Gene: ENSMUSG00000064329
AA Change: Y1246F

DomainStartEndE-ValueType
low complexity region 23 52 N/A INTRINSIC
Pfam:Ion_trans 156 422 5.3e-77 PFAM
low complexity region 431 466 N/A INTRINSIC
Pfam:DUF3451 484 691 2e-62 PFAM
Pfam:Ion_trans 774 963 6.7e-47 PFAM
Pfam:Na_trans_assoc 978 1200 1.2e-74 PFAM
Pfam:Ion_trans 1226 1454 1e-56 PFAM
PDB:1BYY|A 1456 1508 4e-31 PDB
Pfam:Ion_trans 1547 1757 1.1e-51 PFAM
Pfam:PKD_channel 1606 1764 3.8e-7 PFAM
low complexity region 1809 1821 N/A INTRINSIC
IQ 1886 1908 1.65e-2 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000112366
AA Change: Y1274F

PolyPhen 2 Score 0.990 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000107985
Gene: ENSMUSG00000064329
AA Change: Y1274F

DomainStartEndE-ValueType
low complexity region 23 52 N/A INTRINSIC
Pfam:Ion_trans 127 434 2.8e-82 PFAM
Pfam:Na_trans_cytopl 502 718 2e-91 PFAM
Pfam:Ion_trans 767 1002 6.5e-57 PFAM
Pfam:Na_trans_assoc 1006 1213 1.2e-60 PFAM
Pfam:Ion_trans 1217 1493 3.3e-67 PFAM
Pfam:Ion_trans 1540 1797 6.3e-56 PFAM
Pfam:PKD_channel 1637 1791 1.1e-6 PFAM
low complexity region 1837 1849 N/A INTRINSIC
IQ 1914 1936 1.65e-2 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000112371
AA Change: Y1263F

PolyPhen 2 Score 0.891 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000107990
Gene: ENSMUSG00000064329
AA Change: Y1263F

DomainStartEndE-ValueType
low complexity region 23 52 N/A INTRINSIC
Pfam:Ion_trans 156 422 5.4e-77 PFAM
low complexity region 431 466 N/A INTRINSIC
Pfam:DUF3451 484 708 5.5e-73 PFAM
Pfam:Ion_trans 791 980 6.8e-47 PFAM
Pfam:Na_trans_assoc 995 1217 1.2e-74 PFAM
Pfam:Ion_trans 1243 1471 1.1e-56 PFAM
PDB:1BYY|A 1473 1525 4e-31 PDB
Pfam:Ion_trans 1564 1774 1.1e-51 PFAM
Pfam:PKD_channel 1623 1781 3.9e-7 PFAM
low complexity region 1826 1838 N/A INTRINSIC
IQ 1903 1925 1.65e-2 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000156865
AA Change: Y243F

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000144633
Gene: ENSMUSG00000064329
AA Change: Y243F

DomainStartEndE-ValueType
Pfam:Na_trans_assoc 1 182 2.2e-44 PFAM
Pfam:Ion_trans 186 462 1.3e-66 PFAM
Predicted Effect
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Voltage-dependent sodium channels are heteromeric complexes that regulate sodium exchange between intracellular and extracellular spaces and are essential for the generation and propagation of action potentials in muscle cells and neurons. Each sodium channel is composed of a large pore-forming, glycosylated alpha subunit and two smaller beta subunits. This gene encodes a sodium channel alpha subunit, which has four homologous domains, each of which contains six transmembrane regions. Allelic variants of this gene are associated with generalized epilepsy with febrile seizures and epileptic encephalopathy. Alternative splicing results in multiple transcript variants. The RefSeq Project has decided to create four representative RefSeq records. Three of the transcript variants are supported by experimental evidence and the fourth contains alternate 5' untranslated exons, the exact combination of which have not been experimentally confirmed for the full-length transcript. [provided by RefSeq, Oct 2015]
PHENOTYPE: Homozygous null mice show postnatal lethality, seizures and behavioral deficits whereas heterozygotes die prematurely with seizures and abnormal electrophysiology. In addition, knock-in mice exhibit increased susceptibility to febrile and flurothyl-induced seizures, and reduced inhibitory signaling. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abr A G 11: 76,464,282 Y249H probably damaging Het
AF067063 T C 13: 119,828,457 S68G possibly damaging Het
Afdn T A 17: 13,804,008 C59S probably damaging Het
Akap11 C A 14: 78,513,709 V413F Het
Ank3 T C 10: 69,986,832 S444P probably damaging Het
Ankrd12 C T 17: 66,037,604 E91K possibly damaging Het
Arhgap10 A G 8: 77,411,036 S309P probably damaging Het
Arpc2 C A 1: 74,236,882 F19L probably benign Het
Atp5a1 C T 18: 77,781,297 T457I probably damaging Het
Bsn C T 9: 108,111,620 R2311H probably damaging Het
C1ra A G 6: 124,517,424 T277A probably benign Het
Celsr3 C G 9: 108,838,490 L2124V probably benign Het
Cenpv T C 11: 62,525,163 *253W probably null Het
Cfap54 A T 10: 93,039,186 V479E possibly damaging Het
Cmpk2 A T 12: 26,469,569 Y73F probably benign Het
Cpne2 T C 8: 94,555,015 I226T possibly damaging Het
Cyp2c67 C T 19: 39,609,255 R433Q probably damaging Het
Dagla A G 19: 10,254,856 Y489H probably damaging Het
Dennd4a C A 9: 64,842,624 P166T probably damaging Het
Dnm2 C T 9: 21,505,681 R837W possibly damaging Het
Enpp2 C T 15: 54,850,088 R658Q probably benign Het
Gm10521 G A 1: 171,896,463 V114I unknown Het
Gm7534 A G 4: 134,195,459 L521P probably damaging Het
H2-T24 T A 17: 36,017,384 E69V probably damaging Het
H6pd T A 4: 149,995,850 K179N probably damaging Het
Hsf2bp C T 17: 31,987,362 W265* probably null Het
Igfn1 C A 1: 135,973,447 R431L probably damaging Het
Kcng2 T C 18: 80,295,859 S405G possibly damaging Het
Leng9 T C 7: 4,148,448 T410A probably benign Het
Lrp1b T C 2: 40,597,064 Y4557C Het
Ltbp2 G A 12: 84,791,090 P1192L probably benign Het
Mlkl A G 8: 111,316,423 V364A probably benign Het
Mns1 T A 9: 72,449,225 F254Y probably benign Het
Naip1 T A 13: 100,426,176 N827I probably damaging Het
Neb C T 2: 52,256,178 R2929H probably damaging Het
Olfr1025-ps1 A G 2: 85,918,702 Y259C probably benign Het
Olfr111 T A 17: 37,530,928 M317K probably benign Het
Pde10a A G 17: 8,981,656 *797W probably null Het
Pirb T G 7: 3,716,860 H429P probably benign Het
Plbd1 A G 6: 136,617,288 L321P probably damaging Het
Pmfbp1 A G 8: 109,535,839 I722V probably benign Het
Polr2b A G 5: 77,323,638 R274G probably damaging Het
Prune2 C T 19: 17,123,780 T2216I probably benign Het
Psma3 A T 12: 70,994,382 D252V probably benign Het
Ptpn1 C T 2: 167,974,256 T230I probably damaging Het
Rhpn1 T C 15: 75,713,271 V519A possibly damaging Het
Rnf213 T C 11: 119,435,942 V1586A Het
Rrp36 T A 17: 46,672,380 K103* probably null Het
Rsf1 CGGCGGCGG CGGCGGCGGGGGCGGCGG 7: 97,579,923 probably benign Het
Ryr2 T C 13: 11,883,090 T140A probably benign Het
Sdk1 A G 5: 141,956,198 T534A possibly damaging Het
Slc27a5 T C 7: 12,997,713 D117G probably damaging Het
Slc2a1 A T 4: 119,133,410 E246D probably benign Het
Smpd2 T C 10: 41,487,689 D289G probably benign Het
Spag6 A C 2: 18,699,174 E11A probably benign Het
Stard3 G A 11: 98,372,105 probably benign Het
Tcf19 A G 17: 35,515,002 V86A probably damaging Het
Tigit A T 16: 43,659,470 M154K probably benign Het
Trim34a T A 7: 104,260,994 N334K probably damaging Het
Tsen15 T C 1: 152,383,347 I87V probably damaging Het
Ttn A T 2: 76,907,874 M4153K unknown Het
Uchl3 A T 14: 101,668,527 probably null Het
Usp1 A G 4: 98,931,341 K347E probably damaging Het
Vmn1r73 T C 7: 11,756,552 M99T probably benign Het
Vmn2r20 A G 6: 123,385,435 W797R probably damaging Het
Vwa7 A G 17: 35,019,736 T267A probably damaging Het
Other mutations in Scn1a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00513:Scn1a APN 2 66335531 critical splice acceptor site probably null
IGL00650:Scn1a APN 2 66280793 missense probably damaging 1.00
IGL00658:Scn1a APN 2 66286038 missense probably damaging 1.00
IGL00823:Scn1a APN 2 66324935 missense probably benign 0.04
IGL00907:Scn1a APN 2 66327797 missense probably damaging 1.00
IGL01339:Scn1a APN 2 66325960 missense probably benign 0.09
IGL01401:Scn1a APN 2 66289111 missense probably damaging 1.00
IGL01503:Scn1a APN 2 66322343 missense probably damaging 1.00
IGL01575:Scn1a APN 2 66273236 missense probably damaging 1.00
IGL01598:Scn1a APN 2 66302485 missense possibly damaging 0.63
IGL01613:Scn1a APN 2 66285937 missense probably damaging 1.00
IGL01796:Scn1a APN 2 66332301 splice site probably benign
IGL02079:Scn1a APN 2 66323360 missense probably benign 0.14
IGL02171:Scn1a APN 2 66273199 missense probably damaging 1.00
IGL02335:Scn1a APN 2 66277661 missense possibly damaging 0.93
IGL02406:Scn1a APN 2 66326036 missense possibly damaging 0.88
IGL02436:Scn1a APN 2 66351153 missense probably benign 0.01
IGL02507:Scn1a APN 2 66277813 missense probably damaging 1.00
IGL02646:Scn1a APN 2 66299618 splice site probably null
IGL02729:Scn1a APN 2 66299650 missense probably damaging 1.00
IGL02740:Scn1a APN 2 66324762 missense probably damaging 1.00
IGL02740:Scn1a APN 2 66318077 missense probably benign 0.00
IGL02752:Scn1a APN 2 66331412 missense probably damaging 1.00
IGL02815:Scn1a APN 2 66324858 missense probably damaging 1.00
IGL03163:Scn1a APN 2 66318074 missense probably benign 0.00
IGL03229:Scn1a APN 2 66299713 missense probably damaging 1.00
IGL03286:Scn1a APN 2 66277576 missense probably damaging 0.99
IGL03393:Scn1a APN 2 66318018 missense probably benign 0.19
BB008:Scn1a UTSW 2 66317812 missense probably damaging 0.99
BB018:Scn1a UTSW 2 66317812 missense probably damaging 0.99
PIT4791001:Scn1a UTSW 2 66273282 missense probably benign 0.18
R0053:Scn1a UTSW 2 66299775 missense probably benign 0.05
R0053:Scn1a UTSW 2 66299775 missense probably benign 0.05
R0107:Scn1a UTSW 2 66324633 missense probably benign 0.07
R0141:Scn1a UTSW 2 66289062 missense probably damaging 1.00
R0485:Scn1a UTSW 2 66273925 missense probably damaging 0.98
R0517:Scn1a UTSW 2 66302407 missense possibly damaging 0.88
R0532:Scn1a UTSW 2 66317823 missense probably damaging 1.00
R0746:Scn1a UTSW 2 66351126 missense probably benign 0.25
R0755:Scn1a UTSW 2 66321035 missense probably damaging 1.00
R0830:Scn1a UTSW 2 66299784 missense probably damaging 1.00
R0846:Scn1a UTSW 2 66324755 missense probably benign 0.43
R0918:Scn1a UTSW 2 66323307 splice site probably null
R1055:Scn1a UTSW 2 66337996 missense probably benign 0.08
R1432:Scn1a UTSW 2 66322429 missense probably damaging 1.00
R1497:Scn1a UTSW 2 66332287 missense probably damaging 1.00
R1512:Scn1a UTSW 2 66331285 missense possibly damaging 0.82
R1525:Scn1a UTSW 2 66319462 nonsense probably null
R1567:Scn1a UTSW 2 66273331 missense probably damaging 1.00
R1702:Scn1a UTSW 2 66318223 missense probably damaging 1.00
R1744:Scn1a UTSW 2 66322276 missense probably benign 0.06
R1834:Scn1a UTSW 2 66324616 missense probably benign 0.04
R1834:Scn1a UTSW 2 66324617 missense probably benign 0.00
R1860:Scn1a UTSW 2 66317982 missense probably damaging 0.99
R1871:Scn1a UTSW 2 66318025 missense probably damaging 0.98
R1909:Scn1a UTSW 2 66331352 missense possibly damaging 0.58
R1967:Scn1a UTSW 2 66328425 missense probably damaging 1.00
R1976:Scn1a UTSW 2 66331271 missense probably benign 0.02
R2291:Scn1a UTSW 2 66288968 missense probably benign 0.44
R2302:Scn1a UTSW 2 66277745 missense probably damaging 1.00
R2367:Scn1a UTSW 2 66327679 missense probably damaging 1.00
R2418:Scn1a UTSW 2 66273843 missense probably damaging 0.98
R2517:Scn1a UTSW 2 66273832 missense probably damaging 1.00
R2568:Scn1a UTSW 2 66273469 missense probably damaging 1.00
R3083:Scn1a UTSW 2 66299637 missense probably damaging 1.00
R3903:Scn1a UTSW 2 66318132 missense probably benign 0.08
R3909:Scn1a UTSW 2 66273988 missense probably damaging 1.00
R3916:Scn1a UTSW 2 66277613 missense probably damaging 1.00
R3935:Scn1a UTSW 2 66327776 missense probably damaging 0.99
R3936:Scn1a UTSW 2 66327776 missense probably damaging 0.99
R4043:Scn1a UTSW 2 66326036 missense possibly damaging 0.60
R4429:Scn1a UTSW 2 66350985 missense possibly damaging 0.77
R4495:Scn1a UTSW 2 66280802 critical splice acceptor site probably null
R4662:Scn1a UTSW 2 66350988 missense probably benign 0.23
R4834:Scn1a UTSW 2 66328522 nonsense probably null
R4873:Scn1a UTSW 2 66328476 missense possibly damaging 0.92
R4875:Scn1a UTSW 2 66328476 missense possibly damaging 0.92
R5099:Scn1a UTSW 2 66277801 missense probably damaging 1.00
R5255:Scn1a UTSW 2 66277669 missense probably damaging 0.99
R5435:Scn1a UTSW 2 66273534 missense probably damaging 1.00
R5449:Scn1a UTSW 2 66321002 missense probably damaging 0.96
R5519:Scn1a UTSW 2 66332213 missense probably damaging 1.00
R5541:Scn1a UTSW 2 66324633 missense probably benign 0.07
R5556:Scn1a UTSW 2 66324797 missense probably benign 0.00
R5587:Scn1a UTSW 2 66273081 missense probably benign 0.01
R5972:Scn1a UTSW 2 66351110 missense possibly damaging 0.65
R5992:Scn1a UTSW 2 66335456 missense probably damaging 1.00
R6195:Scn1a UTSW 2 66277618 missense possibly damaging 0.59
R6233:Scn1a UTSW 2 66277618 missense possibly damaging 0.59
R6328:Scn1a UTSW 2 66273316 missense probably damaging 1.00
R6417:Scn1a UTSW 2 66273198 missense probably damaging 1.00
R6420:Scn1a UTSW 2 66273198 missense probably damaging 1.00
R6421:Scn1a UTSW 2 66272927 missense probably damaging 1.00
R6461:Scn1a UTSW 2 66326122 missense probably null 0.01
R6701:Scn1a UTSW 2 66337960 missense probably damaging 0.99
R6717:Scn1a UTSW 2 66332287 missense probably damaging 1.00
R6834:Scn1a UTSW 2 66327742 missense probably damaging 1.00
R6918:Scn1a UTSW 2 66332213 missense probably damaging 1.00
R6953:Scn1a UTSW 2 66319469 missense probably damaging 1.00
R6996:Scn1a UTSW 2 66287731 missense probably damaging 1.00
R7022:Scn1a UTSW 2 66317899 missense probably damaging 1.00
R7109:Scn1a UTSW 2 66350942 missense possibly damaging 0.62
R7115:Scn1a UTSW 2 66324618 nonsense probably null
R7239:Scn1a UTSW 2 66277656 splice site probably null
R7434:Scn1a UTSW 2 66273045 missense probably benign
R7646:Scn1a UTSW 2 66287758 missense possibly damaging 0.93
R7711:Scn1a UTSW 2 66303660 missense probably benign
R7879:Scn1a UTSW 2 66286005 nonsense probably null
R7931:Scn1a UTSW 2 66317812 missense probably damaging 0.99
R7962:Scn1a UTSW 2 66328442 missense probably damaging 1.00
R8025:Scn1a UTSW 2 66318213 missense probably benign 0.02
R8055:Scn1a UTSW 2 66319501 missense probably damaging 1.00
R8095:Scn1a UTSW 2 66302465 missense possibly damaging 0.93
R8167:Scn1a UTSW 2 66324838 missense probably damaging 0.98
R8339:Scn1a UTSW 2 66286029 missense probably damaging 1.00
R8363:Scn1a UTSW 2 66322257 missense probably damaging 1.00
R8516:Scn1a UTSW 2 66326134 missense possibly damaging 0.79
R8559:Scn1a UTSW 2 66287733 missense probably damaging 1.00
R8726:Scn1a UTSW 2 66303639 missense probably benign
R8733:Scn1a UTSW 2 66324600 missense probably benign
R8779:Scn1a UTSW 2 66350913 critical splice donor site probably benign
R8841:Scn1a UTSW 2 66326122 missense probably benign 0.09
R8916:Scn1a UTSW 2 66277783 missense probably damaging 1.00
R8919:Scn1a UTSW 2 66337986 missense probably benign 0.16
R9040:Scn1a UTSW 2 66317901 missense probably damaging 0.99
R9086:Scn1a UTSW 2 66351014 missense probably benign 0.01
R9176:Scn1a UTSW 2 66273345 missense probably damaging 1.00
R9228:Scn1a UTSW 2 66299755 missense probably benign 0.10
R9365:Scn1a UTSW 2 66318121 missense probably benign 0.10
R9478:Scn1a UTSW 2 66326149 missense probably benign 0.01
R9560:Scn1a UTSW 2 66327787 missense not run
Z1176:Scn1a UTSW 2 66326128 missense possibly damaging 0.92
Z1177:Scn1a UTSW 2 66324952 critical splice acceptor site probably null
Predicted Primers PCR Primer
(F):5'- CTGGGGAGCCTATCTTGTCATC -3'
(R):5'- CGTTCTTCCATCCCAAGGAAATACC -3'

Sequencing Primer
(F):5'- GGGAGCCTATCTTGTCATCACAAC -3'
(R):5'- TTCCATCCCAAGGAAATACCATGTG -3'
Posted On 2022-03-25