Incidental Mutation 'R4043:Scn1a'
ID313906
Institutional Source Beutler Lab
Gene Symbol Scn1a
Ensembl Gene ENSMUSG00000064329
Gene Namesodium channel, voltage-gated, type I, alpha
SynonymsNav1.1
MMRRC Submission 041615-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4043 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location66270778-66440840 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 66326036 bp
ZygosityHeterozygous
Amino Acid Change Serine to Threonine at position 510 (S510T)
Ref Sequence ENSEMBL: ENSMUSP00000107990 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000077489] [ENSMUST00000094951] [ENSMUST00000112366] [ENSMUST00000112371] [ENSMUST00000138910]
Predicted Effect possibly damaging
Transcript: ENSMUST00000077489
AA Change: S510T

PolyPhen 2 Score 0.595 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000076697
Gene: ENSMUSG00000064329
AA Change: S510T

DomainStartEndE-ValueType
low complexity region 23 52 N/A INTRINSIC
Pfam:Ion_trans 156 422 5.4e-77 PFAM
low complexity region 431 466 N/A INTRINSIC
Pfam:DUF3451 484 708 5.5e-73 PFAM
Pfam:Ion_trans 791 980 6.8e-47 PFAM
Pfam:Na_trans_assoc 995 1217 1.2e-74 PFAM
Pfam:Ion_trans 1243 1471 1.1e-56 PFAM
PDB:1BYY|A 1473 1525 4e-31 PDB
Pfam:Ion_trans 1564 1774 1.1e-51 PFAM
Pfam:PKD_channel 1623 1781 3.9e-7 PFAM
low complexity region 1826 1838 N/A INTRINSIC
IQ 1903 1925 1.65e-2 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000094951
AA Change: S510T

PolyPhen 2 Score 0.595 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000092558
Gene: ENSMUSG00000064329
AA Change: S510T

DomainStartEndE-ValueType
low complexity region 23 52 N/A INTRINSIC
Pfam:Ion_trans 156 422 5.3e-77 PFAM
low complexity region 431 466 N/A INTRINSIC
Pfam:DUF3451 484 691 2e-62 PFAM
Pfam:Ion_trans 774 963 6.7e-47 PFAM
Pfam:Na_trans_assoc 978 1200 1.2e-74 PFAM
Pfam:Ion_trans 1226 1454 1e-56 PFAM
PDB:1BYY|A 1456 1508 4e-31 PDB
Pfam:Ion_trans 1547 1757 1.1e-51 PFAM
Pfam:PKD_channel 1606 1764 3.8e-7 PFAM
low complexity region 1809 1821 N/A INTRINSIC
IQ 1886 1908 1.65e-2 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000112366
AA Change: S510T

PolyPhen 2 Score 0.595 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000107985
Gene: ENSMUSG00000064329
AA Change: S510T

DomainStartEndE-ValueType
low complexity region 23 52 N/A INTRINSIC
Pfam:Ion_trans 127 434 2.8e-82 PFAM
Pfam:Na_trans_cytopl 502 718 2e-91 PFAM
Pfam:Ion_trans 767 1002 6.5e-57 PFAM
Pfam:Na_trans_assoc 1006 1213 1.2e-60 PFAM
Pfam:Ion_trans 1217 1493 3.3e-67 PFAM
Pfam:Ion_trans 1540 1797 6.3e-56 PFAM
Pfam:PKD_channel 1637 1791 1.1e-6 PFAM
low complexity region 1837 1849 N/A INTRINSIC
IQ 1914 1936 1.65e-2 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000112371
AA Change: S510T

PolyPhen 2 Score 0.595 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000107990
Gene: ENSMUSG00000064329
AA Change: S510T

DomainStartEndE-ValueType
low complexity region 23 52 N/A INTRINSIC
Pfam:Ion_trans 156 422 5.4e-77 PFAM
low complexity region 431 466 N/A INTRINSIC
Pfam:DUF3451 484 708 5.5e-73 PFAM
Pfam:Ion_trans 791 980 6.8e-47 PFAM
Pfam:Na_trans_assoc 995 1217 1.2e-74 PFAM
Pfam:Ion_trans 1243 1471 1.1e-56 PFAM
PDB:1BYY|A 1473 1525 4e-31 PDB
Pfam:Ion_trans 1564 1774 1.1e-51 PFAM
Pfam:PKD_channel 1623 1781 3.9e-7 PFAM
low complexity region 1826 1838 N/A INTRINSIC
IQ 1903 1925 1.65e-2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000138910
SMART Domains Protein: ENSMUSP00000116881
Gene: ENSMUSG00000064329

DomainStartEndE-ValueType
low complexity region 23 52 N/A INTRINSIC
transmembrane domain 125 147 N/A INTRINSIC
Meta Mutation Damage Score 0.0798 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.7%
  • 20x: 92.9%
Validation Efficiency 97% (64/66)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Voltage-dependent sodium channels are heteromeric complexes that regulate sodium exchange between intracellular and extracellular spaces and are essential for the generation and propagation of action potentials in muscle cells and neurons. Each sodium channel is composed of a large pore-forming, glycosylated alpha subunit and two smaller beta subunits. This gene encodes a sodium channel alpha subunit, which has four homologous domains, each of which contains six transmembrane regions. Allelic variants of this gene are associated with generalized epilepsy with febrile seizures and epileptic encephalopathy. Alternative splicing results in multiple transcript variants. The RefSeq Project has decided to create four representative RefSeq records. Three of the transcript variants are supported by experimental evidence and the fourth contains alternate 5' untranslated exons, the exact combination of which have not been experimentally confirmed for the full-length transcript. [provided by RefSeq, Oct 2015]
PHENOTYPE: Homozygous null mice show postnatal lethality, seizures and behavioral deficits whereas heterozygotes die prematurely with seizures and abnormal electrophysiology. In addition, knock-in mice exhibit increased susceptibility to febrile and flurothyl-induced seizures, and reduced inhibitory signaling. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4430402I18Rik A T 19: 28,945,783 C80S possibly damaging Het
4930415L06Rik A G X: 89,932,303 F96S probably damaging Het
Adgrf3 T C 5: 30,204,362 N44D probably benign Het
AU018091 A G 7: 3,159,122 F375L probably damaging Het
Bsph1 G T 7: 13,458,276 probably null Het
Casp1 A G 9: 5,302,444 D122G probably benign Het
Ccdc146 C T 5: 21,316,943 C361Y probably benign Het
Cdc37l1 T C 19: 28,990,628 S31P possibly damaging Het
Cdca2 A T 14: 67,704,006 M249K probably benign Het
Cfap73 C T 5: 120,629,965 probably null Het
Cgnl1 A G 9: 71,705,293 L749S probably damaging Het
Cmtr2 C A 8: 110,221,830 C257* probably null Het
Col6a4 A T 9: 106,072,411 L675* probably null Het
Cpne8 A T 15: 90,572,001 D186E probably damaging Het
Csmd3 A G 15: 47,755,966 probably null Het
D330045A20Rik C T X: 139,507,003 S364L probably damaging Het
D430042O09Rik A G 7: 125,868,741 I1366V probably benign Het
Daglb T A 5: 143,487,151 Y354N possibly damaging Het
Dlgap1 T C 17: 70,761,080 S549P probably damaging Het
Dnah11 T C 12: 117,879,943 D4389G probably damaging Het
Dst T A 1: 34,190,684 C2631S probably benign Het
Gimap1 T A 6: 48,743,242 W263R probably damaging Het
Gne A C 4: 44,040,383 C594G possibly damaging Het
Gtf2a1 T C 12: 91,575,667 H47R probably benign Het
Hdac6 T C X: 7,931,492 T993A probably benign Het
Helz2 T C 2: 181,229,710 D2703G probably benign Het
Jmjd1c G A 10: 67,219,466 V222I possibly damaging Het
Kndc1 A G 7: 139,924,129 E1116G probably benign Het
Krt10 C T 11: 99,386,993 probably null Het
Lrrc37a T G 11: 103,498,653 H1982P possibly damaging Het
Med13l T A 5: 118,593,463 L68Q probably damaging Het
Megf10 C A 18: 57,259,798 D422E probably damaging Het
Mpz C T 1: 171,159,771 probably benign Het
Muc5ac A T 7: 141,807,478 T1508S possibly damaging Het
Myo3a C T 2: 22,333,539 probably benign Het
Ndnf A T 6: 65,703,936 N400Y possibly damaging Het
Olfr192 G A 16: 59,098,761 T77I unknown Het
Olfr414 T C 1: 174,431,091 I221T probably damaging Het
Olfr855 G T 9: 19,584,995 V153F probably benign Het
Otol1 A G 3: 70,027,779 D368G probably damaging Het
Pappa A G 4: 65,314,587 N1321S probably benign Het
Patl1 T A 19: 11,942,950 L756Q probably damaging Het
Plcg2 A G 8: 117,612,978 M1043V probably benign Het
Plekhg2 G A 7: 28,364,719 probably benign Het
Ppp2r2d G A 7: 138,882,416 W265* probably null Het
Prss40 G T 1: 34,560,879 S9* probably null Het
Radil T A 5: 142,494,233 I471F probably benign Het
Rpl10l A T 12: 66,284,203 M52K probably damaging Het
Sdad1 T G 5: 92,302,694 N194T probably damaging Het
Sel1l3 A T 5: 53,188,054 Y259* probably null Het
Slc22a26 T C 19: 7,788,329 probably null Het
Snap91 C T 9: 86,777,049 G477D probably damaging Het
Srr T C 11: 74,909,121 T202A probably benign Het
Srrm1 C T 4: 135,340,931 probably benign Het
Trp53bp2 T A 1: 182,449,061 L869Q possibly damaging Het
Ttbk1 T A 17: 46,446,762 D982V probably benign Het
Ttn T C 2: 76,794,157 T15324A probably benign Het
Ush1c T C 7: 46,221,528 E276G probably damaging Het
Vcan T A 13: 89,692,543 L1627F probably benign Het
Vps8 A C 16: 21,526,396 D823A probably damaging Het
Zfp616 T A 11: 74,085,282 N792K possibly damaging Het
Zfpm2 A T 15: 40,870,627 D2V possibly damaging Het
Zfyve16 A C 13: 92,513,763 probably null Het
Zmym2 T A 14: 56,958,308 probably benign Het
Other mutations in Scn1a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00513:Scn1a APN 2 66335531 critical splice acceptor site probably null
IGL00650:Scn1a APN 2 66280793 missense probably damaging 1.00
IGL00658:Scn1a APN 2 66286038 missense probably damaging 1.00
IGL00823:Scn1a APN 2 66324935 missense probably benign 0.04
IGL00907:Scn1a APN 2 66327797 missense probably damaging 1.00
IGL01339:Scn1a APN 2 66325960 missense probably benign 0.09
IGL01401:Scn1a APN 2 66289111 missense probably damaging 1.00
IGL01503:Scn1a APN 2 66322343 missense probably damaging 1.00
IGL01575:Scn1a APN 2 66273236 missense probably damaging 1.00
IGL01598:Scn1a APN 2 66302485 missense possibly damaging 0.63
IGL01613:Scn1a APN 2 66285937 missense probably damaging 1.00
IGL01796:Scn1a APN 2 66332301 splice site probably benign
IGL02079:Scn1a APN 2 66323360 missense probably benign 0.14
IGL02171:Scn1a APN 2 66273199 missense probably damaging 1.00
IGL02335:Scn1a APN 2 66277661 missense possibly damaging 0.93
IGL02406:Scn1a APN 2 66326036 missense possibly damaging 0.88
IGL02436:Scn1a APN 2 66351153 missense probably benign 0.01
IGL02507:Scn1a APN 2 66277813 missense probably damaging 1.00
IGL02646:Scn1a APN 2 66299618 splice site probably null
IGL02729:Scn1a APN 2 66299650 missense probably damaging 1.00
IGL02740:Scn1a APN 2 66324762 missense probably damaging 1.00
IGL02740:Scn1a APN 2 66318077 missense probably benign 0.00
IGL02752:Scn1a APN 2 66331412 missense probably damaging 1.00
IGL02815:Scn1a APN 2 66324858 missense probably damaging 1.00
IGL03163:Scn1a APN 2 66318074 missense probably benign 0.00
IGL03229:Scn1a APN 2 66299713 missense probably damaging 1.00
IGL03286:Scn1a APN 2 66277576 missense probably damaging 0.99
IGL03393:Scn1a APN 2 66318018 missense probably benign 0.19
BB008:Scn1a UTSW 2 66317812 missense probably damaging 0.99
BB018:Scn1a UTSW 2 66317812 missense probably damaging 0.99
PIT4791001:Scn1a UTSW 2 66273282 missense probably benign 0.18
R0053:Scn1a UTSW 2 66299775 missense probably benign 0.05
R0053:Scn1a UTSW 2 66299775 missense probably benign 0.05
R0107:Scn1a UTSW 2 66324633 missense probably benign 0.07
R0141:Scn1a UTSW 2 66289062 missense probably damaging 1.00
R0485:Scn1a UTSW 2 66273925 missense probably damaging 0.98
R0517:Scn1a UTSW 2 66302407 missense possibly damaging 0.88
R0532:Scn1a UTSW 2 66317823 missense probably damaging 1.00
R0746:Scn1a UTSW 2 66351126 missense probably benign 0.25
R0755:Scn1a UTSW 2 66321035 missense probably damaging 1.00
R0830:Scn1a UTSW 2 66299784 missense probably damaging 1.00
R0846:Scn1a UTSW 2 66324755 missense probably benign 0.43
R0918:Scn1a UTSW 2 66323307 splice site probably null
R1055:Scn1a UTSW 2 66337996 missense probably benign 0.08
R1432:Scn1a UTSW 2 66322429 missense probably damaging 1.00
R1497:Scn1a UTSW 2 66332287 missense probably damaging 1.00
R1512:Scn1a UTSW 2 66331285 missense possibly damaging 0.82
R1525:Scn1a UTSW 2 66319462 nonsense probably null
R1567:Scn1a UTSW 2 66273331 missense probably damaging 1.00
R1702:Scn1a UTSW 2 66318223 missense probably damaging 1.00
R1744:Scn1a UTSW 2 66322276 missense probably benign 0.06
R1834:Scn1a UTSW 2 66324616 missense probably benign 0.04
R1834:Scn1a UTSW 2 66324617 missense probably benign 0.00
R1860:Scn1a UTSW 2 66317982 missense probably damaging 0.99
R1871:Scn1a UTSW 2 66318025 missense probably damaging 0.98
R1909:Scn1a UTSW 2 66331352 missense possibly damaging 0.58
R1967:Scn1a UTSW 2 66328425 missense probably damaging 1.00
R1976:Scn1a UTSW 2 66331271 missense probably benign 0.02
R2291:Scn1a UTSW 2 66288968 missense probably benign 0.44
R2302:Scn1a UTSW 2 66277745 missense probably damaging 1.00
R2367:Scn1a UTSW 2 66327679 missense probably damaging 1.00
R2418:Scn1a UTSW 2 66273843 missense probably damaging 0.98
R2517:Scn1a UTSW 2 66273832 missense probably damaging 1.00
R2568:Scn1a UTSW 2 66273469 missense probably damaging 1.00
R3083:Scn1a UTSW 2 66299637 missense probably damaging 1.00
R3903:Scn1a UTSW 2 66318132 missense probably benign 0.08
R3909:Scn1a UTSW 2 66273988 missense probably damaging 1.00
R3916:Scn1a UTSW 2 66277613 missense probably damaging 1.00
R3935:Scn1a UTSW 2 66327776 missense probably damaging 0.99
R3936:Scn1a UTSW 2 66327776 missense probably damaging 0.99
R4429:Scn1a UTSW 2 66350985 missense possibly damaging 0.77
R4495:Scn1a UTSW 2 66280802 critical splice acceptor site probably null
R4662:Scn1a UTSW 2 66350988 missense probably benign 0.23
R4834:Scn1a UTSW 2 66328522 nonsense probably null
R4873:Scn1a UTSW 2 66328476 missense possibly damaging 0.92
R4875:Scn1a UTSW 2 66328476 missense possibly damaging 0.92
R5099:Scn1a UTSW 2 66277801 missense probably damaging 1.00
R5255:Scn1a UTSW 2 66277669 missense probably damaging 0.99
R5435:Scn1a UTSW 2 66273534 missense probably damaging 1.00
R5449:Scn1a UTSW 2 66321002 missense probably damaging 0.96
R5519:Scn1a UTSW 2 66332213 missense probably damaging 1.00
R5541:Scn1a UTSW 2 66324633 missense probably benign 0.07
R5556:Scn1a UTSW 2 66324797 missense probably benign 0.00
R5587:Scn1a UTSW 2 66273081 missense probably benign 0.01
R5972:Scn1a UTSW 2 66351110 missense possibly damaging 0.65
R5992:Scn1a UTSW 2 66335456 missense probably damaging 1.00
R6195:Scn1a UTSW 2 66277618 missense possibly damaging 0.59
R6233:Scn1a UTSW 2 66277618 missense possibly damaging 0.59
R6328:Scn1a UTSW 2 66273316 missense probably damaging 1.00
R6417:Scn1a UTSW 2 66273198 missense probably damaging 1.00
R6420:Scn1a UTSW 2 66273198 missense probably damaging 1.00
R6421:Scn1a UTSW 2 66272927 missense probably damaging 1.00
R6461:Scn1a UTSW 2 66326122 missense probably null 0.01
R6701:Scn1a UTSW 2 66337960 missense probably damaging 0.99
R6717:Scn1a UTSW 2 66332287 missense probably damaging 1.00
R6834:Scn1a UTSW 2 66327742 missense probably damaging 1.00
R6918:Scn1a UTSW 2 66332213 missense probably damaging 1.00
R6953:Scn1a UTSW 2 66319469 missense probably damaging 1.00
R6996:Scn1a UTSW 2 66287731 missense probably damaging 1.00
R7022:Scn1a UTSW 2 66317899 missense probably damaging 1.00
R7109:Scn1a UTSW 2 66350942 missense possibly damaging 0.62
R7115:Scn1a UTSW 2 66324618 nonsense probably null
R7239:Scn1a UTSW 2 66277656 splice site probably null
R7434:Scn1a UTSW 2 66273045 missense probably benign
R7646:Scn1a UTSW 2 66287758 missense possibly damaging 0.93
R7711:Scn1a UTSW 2 66303660 missense probably benign
R7879:Scn1a UTSW 2 66286005 nonsense probably null
R7931:Scn1a UTSW 2 66317812 missense probably damaging 0.99
R7962:Scn1a UTSW 2 66328442 missense probably damaging 1.00
R8025:Scn1a UTSW 2 66318213 missense probably benign 0.02
R8055:Scn1a UTSW 2 66319501 missense probably damaging 1.00
R8095:Scn1a UTSW 2 66302465 missense possibly damaging 0.93
R8167:Scn1a UTSW 2 66324838 missense probably damaging 0.98
R8339:Scn1a UTSW 2 66286029 missense probably damaging 1.00
R8363:Scn1a UTSW 2 66322257 missense probably damaging 1.00
R8516:Scn1a UTSW 2 66326134 missense possibly damaging 0.79
R8559:Scn1a UTSW 2 66287733 missense probably damaging 1.00
R8726:Scn1a UTSW 2 66303639 missense probably benign
R8733:Scn1a UTSW 2 66324600 missense probably benign
R8779:Scn1a UTSW 2 66350913 critical splice donor site probably benign
Z1176:Scn1a UTSW 2 66326128 missense possibly damaging 0.92
Z1177:Scn1a UTSW 2 66324952 critical splice acceptor site probably null
Predicted Primers PCR Primer
(F):5'- TCGGTTGATGAAAACCCATCC -3'
(R):5'- GCAACACACTGAATTGGTTTCTC -3'

Sequencing Primer
(F):5'- AGATGGCTCACTCTCATCGGTG -3'
(R):5'- GGTTTCTCCTCTATATAGCAGGCAG -3'
Posted On2015-04-30