Mutagenetix > Incidental Mutation

Incidental Mutation 'R9293:Mre11a'

704397

Institutional Source

Beutler Lab

Gene Symbol

Mre11a

Ensembl Gene

ENSMUSG00000031928

Gene Name

MRE11A homolog A, double strand break repair nuclease

Synonyms

MMRRC Submission

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R9293 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

14784654-14837123 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 14799588 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Phenylalanine to Leucine at position 193 (F193L)

Ref Sequence

ENSEMBL: ENSMUSP00000111295 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000034405] [ENSMUST00000115632] [ENSMUST00000147305]

AlphaFold

Q61216

Predicted Effect

probably damaging
Transcript: ENSMUST00000034405
AA Change: F193L

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000034405
Gene: ENSMUSG00000031928
AA Change: F193L

Domain	Start	End	E-Value	Type
Pfam:Metallophos	13	249	6.3e-15	PFAM
Mre11_DNA_bind	294	462	1.72e-70	SMART
coiled coil region	487	519	N/A	INTRINSIC
low complexity region	566	594	N/A	INTRINSIC
low complexity region	683	699	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000115632
AA Change: F193L

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000111295
Gene: ENSMUSG00000031928
AA Change: F193L

Domain	Start	End	E-Value	Type
Pfam:Metallophos	13	249	1.1e-31	PFAM
Mre11_DNA_bind	294	435	7.6e-49	SMART
coiled coil region	460	492	N/A	INTRINSIC
low complexity region	539	567	N/A	INTRINSIC
low complexity region	656	672	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000136568

SMART Domains

Protein: ENSMUSP00000121012
Gene: ENSMUSG00000031928

Domain	Start	End	E-Value	Type
PDB:3T1I\|D	1	107	1e-70	PDB
SCOP:d1ii7a_	3	107	7e-8	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000147305
AA Change: F193L

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000116321
Gene: ENSMUSG00000031928
AA Change: F193L

Domain	Start	End	E-Value	Type
Pfam:Metallophos	13	199	1.2e-22	PFAM

Predicted Effect

SMART Domains

Protein: ENSMUSP00000119999
Gene: ENSMUSG00000031928
AA Change: F22L

Domain	Start	End	E-Value	Type
PDB:3T1I\|D	2	50	3e-26	PDB
Mre11_DNA_bind	62	170	1.81e-32	SMART

Meta Mutation Damage Score

0.4193

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.7%
20x: 98.8%

Validation Efficiency

95% (54/57)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a nuclear protein involved in homologous recombination, telomere length maintenance, and DNA double-strand break repair. By itself, the protein has 3' to 5' exonuclease activity and endonuclease activity. The protein forms a complex with the RAD50 homolog; this complex is required for nonhomologous joining of DNA ends and possesses increased single-stranded DNA endonuclease and 3' to 5' exonuclease activities. In conjunction with a DNA ligase, this protein promotes the joining of noncomplementary ends in vitro using short homologies near the ends of the DNA fragments. This gene has a pseudogene on chromosome 3. Alternative splicing of this gene results in two transcript variants encoding different isoforms. [provided by RefSeq, Jul 2008]
PHENOTYPE: Though mutation of this locus affected chromosome stability, mutant mice were no more susceptible to tumorigenesis than wild-type mice. Mutant female mice showed reduced fertility. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 57 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1110002E22Rik	T	C	3: 138,066,078	S343P	possibly damaging	Het
1700007G11Rik	C	T	5: 98,498,303	A86V	probably benign	Het
4930563M21Rik	T	A	9: 56,009,284	E36D	unknown	Het
Abcc8	T	G	7: 46,106,668	K1450T	probably benign	Het
Aox2	A	T	1: 58,322,794	N720Y	possibly damaging	Het
AW549877	T	C	15: 3,991,854	D73G	probably damaging	Het
BC034090	T	C	1: 155,225,772	T249A	probably benign	Het
Brf2	A	T	8: 27,123,993	S388R	probably damaging	Het
Ccdc180	A	T	4: 45,944,461	Q1437L	probably damaging	Het
Cdc42ep1	A	C	15: 78,849,825	D375A	probably benign	Het
Cep85l	T	C	10: 53,298,186	Y487C	probably damaging	Het
Chd3	C	T	11: 69,353,201	R1346H	possibly damaging	Het
Cltc	T	A	11: 86,712,620	R793S	possibly damaging	Het
Crat	A	G	2: 30,408,202	F162L	probably benign	Het
Cyp3a44	C	A	5: 145,774,377	V495L	probably benign	Het
Dchs2	C	T	3: 83,282,054	T1575I	possibly damaging	Het
Ddx60	A	G	8: 62,009,960	T1292A	possibly damaging	Het
Dnah12	C	T	14: 26,773,059	A109V	probably benign	Het
Foxo3	C	T	10: 42,197,025	V499M	probably damaging	Het
Fry	T	C	5: 150,495,832	S546P		Het
Hfe	T	C	13: 23,706,809	K204E	probably benign	Het
Hibch	T	A	1: 52,913,827	Y329N	probably damaging	Het
Irf9	T	G	14: 55,608,790	I426S	probably damaging	Het
Kif26a	C	A	12: 112,146,401	P13T	probably damaging	Het
Lhx5	A	C	5: 120,432,386	K36Q	probably benign	Het
Mdn1	T	C	4: 32,707,579	S1623P	probably damaging	Het
Mybl2	G	A	2: 163,068,215	G187E	probably damaging	Het
Myh1	A	T	11: 67,209,103	Q613L	probably benign	Het
Myo5a	T	A	9: 75,180,030	M1056K	probably benign	Het
Olfr1	T	C	11: 73,395,129	K298E	probably damaging	Het
Olfr1197	G	A	2: 88,729,455	T48I	probably benign	Het
Olfr610	C	T	7: 103,506,520	R142H	probably benign	Het
Olfr918	T	C	9: 38,673,118	I109V	probably damaging	Het
Pcdhga12	G	A	18: 37,767,887	V591M	probably damaging	Het
Phyhipl	A	G	10: 70,565,286	S161P	probably damaging	Het
Pmfbp1	A	G	8: 109,536,573	T775A	probably benign	Het
Pou3f3	T	C	1: 42,697,522	V126A	unknown	Het
Reg4	A	C	3: 98,236,315	K142Q	possibly damaging	Het
Sec22c	G	T	9: 121,688,248	A199E	probably damaging	Het
Sema3d	C	T	5: 12,553,214	P395S	probably damaging	Het
Sh2b2	C	T	5: 136,232,039	E108K	possibly damaging	Het
Slfn3	A	G	11: 83,214,790	K538E	possibly damaging	Het
Spatc1l	A	T	10: 76,569,366	D194V	probably damaging	Het
Stoml3	T	C	3: 53,500,764	V77A	possibly damaging	Het
Taco1	A	G	11: 106,073,104	I230V	probably benign	Het
Tfcp2	T	C	15: 100,514,053	T346A	probably benign	Het
Tmem8b	C	T	4: 43,686,188	T273M	probably damaging	Het
Trav6-1	A	G	14: 52,638,842	N73S	probably benign	Het
Trav6d-5	A	G	14: 52,795,603	D103G	probably damaging	Het
Ttll5	T	A	12: 85,891,032	L379Q	probably damaging	Het
Ube3c	T	A	5: 29,598,848		probably benign	Het
Ubr3	A	C	2: 69,897,425	D44A	probably benign	Het
Upp2	G	T	2: 58,567,431	R5L	unknown	Het
Vmn1r43	G	A	6: 89,869,895	T203M	probably damaging	Het
Vmn2r17	C	T	5: 109,452,846	T670I	probably damaging	Het
Zfp433	A	T	10: 81,720,288	H208L	probably damaging	Het
Zfp616	A	T	11: 74,083,918	I429F	possibly damaging	Het

Other mutations in Mre11a

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00156:Mre11a	APN	9	14825208	missense	probably benign	0.28
IGL00429:Mre11a	APN	9	14802813	missense	probably damaging	1.00
IGL00922:Mre11a	APN	9	14799588	missense	probably damaging	1.00
IGL01095:Mre11a	APN	9	14809824	missense	probably benign
IGL01294:Mre11a	APN	9	14830915	missense	probably damaging	0.97
IGL01871:Mre11a	APN	9	14811897	missense	possibly damaging	0.95
IGL02194:Mre11a	APN	9	14815209	missense	possibly damaging	0.70
IGL02213:Mre11a	APN	9	14811884	missense	probably damaging	1.00
IGL02245:Mre11a	APN	9	14815276	unclassified	probably benign
IGL02749:Mre11a	APN	9	14826591	missense	possibly damaging	0.78
IGL02812:Mre11a	APN	9	14790670	splice site	probably null
bow	UTSW	9	14786962	missense	probably damaging	1.00
R0050:Mre11a	UTSW	9	14830973	splice site	probably benign
R0594:Mre11a	UTSW	9	14815209	missense	probably benign	0.00
R1241:Mre11a	UTSW	9	14799639	missense	probably damaging	1.00
R1905:Mre11a	UTSW	9	14799627	missense	probably benign	0.08
R2030:Mre11a	UTSW	9	14795805	missense	probably damaging	1.00
R2270:Mre11a	UTSW	9	14815174	missense	probably benign	0.00
R2511:Mre11a	UTSW	9	14795769	critical splice acceptor site	probably null
R2851:Mre11a	UTSW	9	14826547	missense	probably benign	0.00
R2852:Mre11a	UTSW	9	14826547	missense	probably benign	0.00
R2853:Mre11a	UTSW	9	14826547	missense	probably benign	0.00
R3765:Mre11a	UTSW	9	14809847	missense	probably benign	0.25
R4612:Mre11a	UTSW	9	14802903	missense	probably damaging	1.00
R5007:Mre11a	UTSW	9	14809820	missense	probably benign	0.10
R5343:Mre11a	UTSW	9	14811834	missense	probably damaging	0.98
R5679:Mre11a	UTSW	9	14786919	missense	probably damaging	0.99
R5834:Mre11a	UTSW	9	14799657	missense	probably benign	0.15
R5914:Mre11a	UTSW	9	14811936	missense	probably damaging	1.00
R5935:Mre11a	UTSW	9	14786962	missense	probably damaging	1.00
R6089:Mre11a	UTSW	9	14819464	missense	probably benign	0.02
R6393:Mre11a	UTSW	9	14785509	start codon destroyed	probably null	0.00
R6625:Mre11a	UTSW	9	14805391	missense	possibly damaging	0.52
R7248:Mre11a	UTSW	9	14811913	missense	possibly damaging	0.52
R7744:Mre11a	UTSW	9	14809832	missense	possibly damaging	0.94
R7999:Mre11a	UTSW	9	14799669	nonsense	probably null
R8179:Mre11a	UTSW	9	14797066	missense	probably null	1.00
R9302:Mre11a	UTSW	9	14785530	critical splice donor site	probably null
R9368:Mre11a	UTSW	9	14825218	missense	probably benign
R9410:Mre11a	UTSW	9	14805420	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- AGCACAGGGAGTTCCTTTATTTC -3'
(R):5'- GTGAAGGAGTCAGGCCTTTAC -3'

Sequencing Primer
(F):5'- TCCTGATTGCTAAATGGAAAGCGTG -3'
(R):5'- CTTAAAGGCCTGCGCAAATAGGTC -3'

Posted On

2022-03-25