Incidental Mutation 'R3765:Mre11a'
ID 274655
Institutional Source Beutler Lab
Gene Symbol Mre11a
Ensembl Gene ENSMUSG00000031928
Gene Name MRE11A homolog A, double strand break repair nuclease
Synonyms
MMRRC Submission 040742-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R3765 (G1)
Quality Score 225
Status Not validated
Chromosome 9
Chromosomal Location 14784654-14837123 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 14809847 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Asparagine to Serine at position 354 (N354S)
Ref Sequence ENSEMBL: ENSMUSP00000034405 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034405] [ENSMUST00000115632]
AlphaFold Q61216
Predicted Effect probably benign
Transcript: ENSMUST00000034405
AA Change: N354S

PolyPhen 2 Score 0.245 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000034405
Gene: ENSMUSG00000031928
AA Change: N354S

DomainStartEndE-ValueType
Pfam:Metallophos 13 249 6.3e-15 PFAM
Mre11_DNA_bind 294 462 1.72e-70 SMART
coiled coil region 487 519 N/A INTRINSIC
low complexity region 566 594 N/A INTRINSIC
low complexity region 683 699 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000115632
SMART Domains Protein: ENSMUSP00000111295
Gene: ENSMUSG00000031928

DomainStartEndE-ValueType
Pfam:Metallophos 13 249 1.1e-31 PFAM
Mre11_DNA_bind 294 435 7.6e-49 SMART
coiled coil region 460 492 N/A INTRINSIC
low complexity region 539 567 N/A INTRINSIC
low complexity region 656 672 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000147676
AA Change: N121S
SMART Domains Protein: ENSMUSP00000119999
Gene: ENSMUSG00000031928
AA Change: N121S

DomainStartEndE-ValueType
PDB:3T1I|D 2 50 3e-26 PDB
Mre11_DNA_bind 62 170 1.81e-32 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000216810
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a nuclear protein involved in homologous recombination, telomere length maintenance, and DNA double-strand break repair. By itself, the protein has 3' to 5' exonuclease activity and endonuclease activity. The protein forms a complex with the RAD50 homolog; this complex is required for nonhomologous joining of DNA ends and possesses increased single-stranded DNA endonuclease and 3' to 5' exonuclease activities. In conjunction with a DNA ligase, this protein promotes the joining of noncomplementary ends in vitro using short homologies near the ends of the DNA fragments. This gene has a pseudogene on chromosome 3. Alternative splicing of this gene results in two transcript variants encoding different isoforms. [provided by RefSeq, Jul 2008]
PHENOTYPE: Though mutation of this locus affected chromosome stability, mutant mice were no more susceptible to tumorigenesis than wild-type mice. Mutant female mice showed reduced fertility. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Akap13 T C 7: 75,608,837 V403A probably benign Het
Arid2 T C 15: 96,370,714 S903P probably benign Het
Arl6ip6 T A 2: 53,192,231 W37R probably damaging Het
Bag3 C T 7: 128,540,271 T162I probably benign Het
C4b G A 17: 34,729,840 P1545S probably damaging Het
Ccdc185 T A 1: 182,747,552 H524L possibly damaging Het
Cfap43 T C 19: 47,835,575 N119S probably benign Het
Churc1 C A 12: 76,773,283 S22* probably null Het
Crbn T C 6: 106,795,026 K106E possibly damaging Het
Dag1 C T 9: 108,208,199 G581E probably damaging Het
Dpp4 T A 2: 62,386,436 T92S probably benign Het
Fam135a T C 1: 24,055,877 T137A possibly damaging Het
Fermt1 T C 2: 132,906,702 D667G possibly damaging Het
Foxl2 T A 9: 98,955,986 I109N probably damaging Het
Frk A G 10: 34,484,005 M1V probably null Het
Fuk A G 8: 110,887,104 I775T probably benign Het
Gstm2 A G 3: 107,984,030 F124S probably damaging Het
Hmcn1 T C 1: 150,745,025 S1145G possibly damaging Het
Ints10 A G 8: 68,825,119 T682A possibly damaging Het
Jmy T C 13: 93,464,711 M396V possibly damaging Het
Ldb3 A T 14: 34,578,682 probably null Het
Nbea A G 3: 56,005,549 V939A probably damaging Het
Nphs1 T C 7: 30,471,210 S928P probably damaging Het
Olfr1463 G A 19: 13,234,431 M60I probably damaging Het
Olfr19 A G 16: 16,673,315 V222A probably benign Het
Olfr311 T C 11: 58,841,294 F60S probably damaging Het
Olfr954 T A 9: 39,461,624 Y61* probably null Het
Pla2g12b G A 10: 59,421,501 V169M probably damaging Het
Polr1c C T 17: 46,247,924 V14M probably damaging Het
Prg4 G A 1: 150,451,371 S898L probably damaging Het
Prmt6 C A 3: 110,250,194 E260* probably null Het
Ptx4 A G 17: 25,122,868 T106A probably benign Het
Rab3il1 A G 19: 10,028,309 T87A probably damaging Het
Sbf2 A G 7: 110,375,581 V783A probably damaging Het
Scn2a A C 2: 65,682,710 D209A possibly damaging Het
Setd2 T C 9: 110,594,246 L345P probably damaging Het
Slc18b1 A G 10: 23,798,749 D34G probably damaging Het
Slc9c1 A T 16: 45,590,881 M934L possibly damaging Het
Slx4 A G 16: 3,980,986 V1357A probably damaging Het
Spidr T C 16: 15,968,640 E413G probably benign Het
Taar1 A G 10: 23,921,307 Y301C probably damaging Het
Tada2b A T 5: 36,476,417 D197E probably benign Het
Taf1c G T 8: 119,600,485 Y418* probably null Het
Tanc2 A G 11: 105,914,970 D394G probably damaging Het
Tnpo3 T C 6: 29,579,689 D235G probably benign Het
Tns3 G A 11: 8,451,133 A1055V probably benign Het
Wdfy3 A G 5: 101,861,400 Y2767H probably damaging Het
Zfhx3 A G 8: 108,792,762 N172S probably damaging Het
Zfp839 T C 12: 110,855,163 V137A probably benign Het
Other mutations in Mre11a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00156:Mre11a APN 9 14825208 missense probably benign 0.28
IGL00429:Mre11a APN 9 14802813 missense probably damaging 1.00
IGL00922:Mre11a APN 9 14799588 missense probably damaging 1.00
IGL01095:Mre11a APN 9 14809824 missense probably benign
IGL01294:Mre11a APN 9 14830915 missense probably damaging 0.97
IGL01871:Mre11a APN 9 14811897 missense possibly damaging 0.95
IGL02194:Mre11a APN 9 14815209 missense possibly damaging 0.70
IGL02213:Mre11a APN 9 14811884 missense probably damaging 1.00
IGL02245:Mre11a APN 9 14815276 unclassified probably benign
IGL02749:Mre11a APN 9 14826591 missense possibly damaging 0.78
IGL02812:Mre11a APN 9 14790670 splice site probably null
bow UTSW 9 14786962 missense probably damaging 1.00
R0050:Mre11a UTSW 9 14830973 splice site probably benign
R0594:Mre11a UTSW 9 14815209 missense probably benign 0.00
R1241:Mre11a UTSW 9 14799639 missense probably damaging 1.00
R1905:Mre11a UTSW 9 14799627 missense probably benign 0.08
R2030:Mre11a UTSW 9 14795805 missense probably damaging 1.00
R2270:Mre11a UTSW 9 14815174 missense probably benign 0.00
R2511:Mre11a UTSW 9 14795769 critical splice acceptor site probably null
R2851:Mre11a UTSW 9 14826547 missense probably benign 0.00
R2852:Mre11a UTSW 9 14826547 missense probably benign 0.00
R2853:Mre11a UTSW 9 14826547 missense probably benign 0.00
R4612:Mre11a UTSW 9 14802903 missense probably damaging 1.00
R5007:Mre11a UTSW 9 14809820 missense probably benign 0.10
R5343:Mre11a UTSW 9 14811834 missense probably damaging 0.98
R5679:Mre11a UTSW 9 14786919 missense probably damaging 0.99
R5834:Mre11a UTSW 9 14799657 missense probably benign 0.15
R5914:Mre11a UTSW 9 14811936 missense probably damaging 1.00
R5935:Mre11a UTSW 9 14786962 missense probably damaging 1.00
R6089:Mre11a UTSW 9 14819464 missense probably benign 0.02
R6393:Mre11a UTSW 9 14785509 start codon destroyed probably null 0.00
R6625:Mre11a UTSW 9 14805391 missense possibly damaging 0.52
R7248:Mre11a UTSW 9 14811913 missense possibly damaging 0.52
R7744:Mre11a UTSW 9 14809832 missense possibly damaging 0.94
R7999:Mre11a UTSW 9 14799669 nonsense probably null
R8179:Mre11a UTSW 9 14797066 missense probably null 1.00
R9293:Mre11a UTSW 9 14799588 missense probably damaging 1.00
R9302:Mre11a UTSW 9 14785530 critical splice donor site probably null
R9368:Mre11a UTSW 9 14825218 missense probably benign
R9410:Mre11a UTSW 9 14805420 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACTGTTAAGGGACGAGGTTG -3'
(R):5'- AGTTCACCTGAGATTAGACCAAGC -3'

Sequencing Primer
(F):5'- GGCCACAAGCTTTAAATGATGC -3'
(R):5'- TGAGATTAGACCAAGCCCACAG -3'
Posted On 2015-04-02