Mutagenetix > Incidental Mutation

Incidental Mutation 'R1905:Mre11a'

214290

Institutional Source

Beutler Lab

Gene Symbol

Mre11a

Ensembl Gene

ENSMUSG00000031928

Gene Name

MRE11A homolog A, double strand break repair nuclease

Synonyms

MMRRC Submission

039924-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R1905 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

14784654-14837123 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to A at 14799627 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Asparagine at position 206 (D206N)

Ref Sequence

ENSEMBL: ENSMUSP00000111295 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000034405] [ENSMUST00000115632] [ENSMUST00000147305]

AlphaFold

Q61216

Predicted Effect

probably benign
Transcript: ENSMUST00000034405
AA Change: D206N

PolyPhen 2 Score 0.080 (Sensitivity: 0.93; Specificity: 0.85)

SMART Domains

Protein: ENSMUSP00000034405
Gene: ENSMUSG00000031928
AA Change: D206N

Domain	Start	End	E-Value	Type
Pfam:Metallophos	13	249	6.3e-15	PFAM
Mre11_DNA_bind	294	462	1.72e-70	SMART
coiled coil region	487	519	N/A	INTRINSIC
low complexity region	566	594	N/A	INTRINSIC
low complexity region	683	699	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000115632
AA Change: D206N

PolyPhen 2 Score 0.080 (Sensitivity: 0.93; Specificity: 0.85)

SMART Domains

Protein: ENSMUSP00000111295
Gene: ENSMUSG00000031928
AA Change: D206N

Domain	Start	End	E-Value	Type
Pfam:Metallophos	13	249	1.1e-31	PFAM
Mre11_DNA_bind	294	435	7.6e-49	SMART
coiled coil region	460	492	N/A	INTRINSIC
low complexity region	539	567	N/A	INTRINSIC
low complexity region	656	672	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000136568

SMART Domains

Protein: ENSMUSP00000121012
Gene: ENSMUSG00000031928

Domain	Start	End	E-Value	Type
PDB:3T1I\|D	1	107	1e-70	PDB
SCOP:d1ii7a_	3	107	7e-8	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000147305

SMART Domains

Protein: ENSMUSP00000116321
Gene: ENSMUSG00000031928

Domain	Start	End	E-Value	Type
Pfam:Metallophos	13	199	1.2e-22	PFAM

Predicted Effect

unknown
Transcript: ENSMUST00000147676
AA Change: D35N

SMART Domains

Protein: ENSMUSP00000119999
Gene: ENSMUSG00000031928
AA Change: D35N

Domain	Start	End	E-Value	Type
PDB:3T1I\|D	2	50	3e-26	PDB
Mre11_DNA_bind	62	170	1.81e-32	SMART

Meta Mutation Damage Score

0.0726

Coding Region Coverage

1x: 97.5%
3x: 97.0%
10x: 95.5%
20x: 93.1%

Validation Efficiency

99% (90/91)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a nuclear protein involved in homologous recombination, telomere length maintenance, and DNA double-strand break repair. By itself, the protein has 3' to 5' exonuclease activity and endonuclease activity. The protein forms a complex with the RAD50 homolog; this complex is required for nonhomologous joining of DNA ends and possesses increased single-stranded DNA endonuclease and 3' to 5' exonuclease activities. In conjunction with a DNA ligase, this protein promotes the joining of noncomplementary ends in vitro using short homologies near the ends of the DNA fragments. This gene has a pseudogene on chromosome 3. Alternative splicing of this gene results in two transcript variants encoding different isoforms. [provided by RefSeq, Jul 2008]
PHENOTYPE: Though mutation of this locus affected chromosome stability, mutant mice were no more susceptible to tumorigenesis than wild-type mice. Mutant female mice showed reduced fertility. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 89 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4833420G17Rik	G	T	13: 119,469,680	V153L	possibly damaging	Het
Adamts17	T	A	7: 67,047,472	C631*	probably null	Het
Adamts19	A	G	18: 59,032,945	R1070G	possibly damaging	Het
Aldh1a1	A	G	19: 20,617,998	E97G	probably damaging	Het
Bola2	T	A	7: 126,696,238	V40E	probably damaging	Het
Ccar1	A	G	10: 62,776,658	S243P	possibly damaging	Het
Cd80	A	T	16: 38,474,177	I141F	probably damaging	Het
Chn2	T	C	6: 54,286,121	C92R	probably damaging	Het
Clk1	A	T	1: 58,421,942		probably benign	Het
Clock	T	C	5: 76,266,888		probably benign	Het
Cntnap3	A	G	13: 64,903,764	V26A	probably benign	Het
Csf3r	A	T	4: 126,042,745	K651N	probably benign	Het
Cul4a	T	C	8: 13,133,171	M322T	probably benign	Het
Cx3cl1	A	G	8: 94,780,059	T231A	probably benign	Het
Cyp2c68	A	T	19: 39,735,582	C213S	probably benign	Het
Dhx16	T	G	17: 35,888,355	S814A	probably benign	Het
Dnah1	T	C	14: 31,264,630	I3659V	probably benign	Het
Dock6	A	T	9: 21,829,574	V906D	probably benign	Het
Ep400	G	A	5: 110,670,948	T2738I	probably damaging	Het
Erbb4	A	T	1: 68,075,410		probably benign	Het
Fam135b	C	T	15: 71,532,987	R70H	probably damaging	Het
Fam13a	T	C	6: 58,953,490	Q479R	probably damaging	Het
Fam96a	A	G	9: 66,132,647	K82R	probably benign	Het
Fcgr4	A	T	1: 171,029,305	Q247L	probably damaging	Het
Flnc	T	A	6: 29,459,460	C2520S	probably damaging	Het
Foxn1	A	G	11: 78,371,810		probably null	Het
Fsip2	C	T	2: 82,983,428	P3364S	possibly damaging	Het
Fzd8	C	T	18: 9,213,803	T295I	probably damaging	Het
Gm10499	T	C	17: 36,142,941		noncoding transcript	Het
Gm340	A	G	19: 41,583,574	D256G	possibly damaging	Het
Gm4744	G	A	6: 40,951,802		probably benign	Het
Gm4871	G	T	5: 145,030,049	A208D	probably damaging	Het
Gm5155	T	A	7: 17,873,552		noncoding transcript	Het
Gm527	A	G	12: 64,921,023	N73S	possibly damaging	Het
Gm5414	T	C	15: 101,624,640	I451V	probably damaging	Het
Golm1	A	T	13: 59,642,251	V245E	probably benign	Het
Grik1	A	T	16: 87,896,866	Y879*	probably null	Het
Grn	C	A	11: 102,436,450	P241Q	probably damaging	Het
Hjurp	T	C	1: 88,266,616	E190G	probably benign	Het
Hmcn1	A	C	1: 150,992,855	I66S	probably damaging	Het
Hykk	T	A	9: 54,946,383	Y330N	probably benign	Het
Khdc1c	A	G	1: 21,369,057	N89S	probably benign	Het
Lrrc72	T	A	12: 36,208,662		probably null	Het
Lyst	T	G	13: 13,634,134	S130A	probably benign	Het
Mast1	G	A	8: 84,916,266	R967C	probably damaging	Het
Mfng	T	C	15: 78,773,086	T63A	probably damaging	Het
Myh10	A	G	11: 68,771,868		probably benign	Het
Myt1	A	G	2: 181,797,756	D357G	probably damaging	Het
Nacad	T	A	11: 6,602,540	H217L	probably benign	Het
Ncoa1	A	G	12: 4,295,433	V638A	probably damaging	Het
Nlrp3	T	G	11: 59,549,036	F480V	probably damaging	Het
Nos1ap	A	G	1: 170,318,558	W476R	possibly damaging	Het
Nr1h4	T	A	10: 89,480,559	T220S	possibly damaging	Het
Ntf5	G	T	7: 45,415,752	V103L	probably damaging	Het
Ntm	C	A	9: 29,179,097	D109Y	probably damaging	Het
Olfr18	C	T	9: 20,314,846	E17K	probably benign	Het
P2rx7	G	A	5: 122,680,952	C479Y	probably damaging	Het
Pappa2	T	A	1: 158,803,503		probably null	Het
Pgap1	A	C	1: 54,511,961	I520R	probably benign	Het
Pikfyve	G	A	1: 65,192,295		probably null	Het
Plekhg3	T	C	12: 76,576,217	S744P	probably benign	Het
Pramel6	A	G	2: 87,509,182	R97G	probably damaging	Het
Pramel6	G	T	2: 87,509,183	R97M	probably damaging	Het
Psme4	T	C	11: 30,810,922	V397A	probably damaging	Het
Ptk2b	T	C	14: 66,158,670	D783G	probably damaging	Het
Ptma-ps1	T	A	7: 24,063,881	L17*	probably null	Het
Ralgapa2	C	A	2: 146,387,701	R1053L	probably damaging	Het
Sap130	C	T	18: 31,680,567	P559L	possibly damaging	Het
Sap30	T	C	8: 57,487,311	S86G	probably damaging	Het
Sdk2	C	T	11: 113,838,646		silent	Het
Sema3f	G	T	9: 107,684,376	Q500K	probably damaging	Het
Serpinb3d	T	C	1: 107,079,284	I231M	possibly damaging	Het
Sf3a1	T	A	11: 4,176,678	N563K	probably benign	Het
Sipa1l3	A	G	7: 29,339,167	S352P	possibly damaging	Het
Slc6a12	G	T	6: 121,347,443	E9*	probably null	Het
Srebf1	T	C	11: 60,204,493	D400G	probably damaging	Het
Swsap1	T	C	9: 21,956,692	Y87H	probably damaging	Het
Tanc2	G	A	11: 105,922,863	G1711D	possibly damaging	Het
Tas2r107	T	C	6: 131,659,988	M33V	probably benign	Het
Tdrd9	T	A	12: 112,063,627		probably benign	Het
Tdrp	T	C	8: 13,954,079	D86G	probably damaging	Het
Tmem92	A	T	11: 94,778,675	M106K	probably benign	Het
Tmf1	A	T	6: 97,161,479	C764S	possibly damaging	Het
Ttc21a	G	T	9: 119,966,757	R1219L	possibly damaging	Het
Ttn	C	T	2: 76,763,448	G18870D	probably damaging	Het
Tubgcp6	T	C	15: 89,100,608	Y1732C	probably damaging	Het
Vmn1r28	A	G	6: 58,265,927	T252A	probably benign	Het
Xirp2	A	G	2: 67,516,356	I2980M	probably damaging	Het
Zc2hc1c	A	G	12: 85,290,514	D315G	probably benign	Het

Other mutations in Mre11a

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00156:Mre11a	APN	9	14825208	missense	probably benign	0.28
IGL00429:Mre11a	APN	9	14802813	missense	probably damaging	1.00
IGL00922:Mre11a	APN	9	14799588	missense	probably damaging	1.00
IGL01095:Mre11a	APN	9	14809824	missense	probably benign
IGL01294:Mre11a	APN	9	14830915	missense	probably damaging	0.97
IGL01871:Mre11a	APN	9	14811897	missense	possibly damaging	0.95
IGL02194:Mre11a	APN	9	14815209	missense	possibly damaging	0.70
IGL02213:Mre11a	APN	9	14811884	missense	probably damaging	1.00
IGL02245:Mre11a	APN	9	14815276	unclassified	probably benign
IGL02749:Mre11a	APN	9	14826591	missense	possibly damaging	0.78
IGL02812:Mre11a	APN	9	14790670	splice site	probably null
bow	UTSW	9	14786962	missense	probably damaging	1.00
R0050:Mre11a	UTSW	9	14830973	splice site	probably benign
R0594:Mre11a	UTSW	9	14815209	missense	probably benign	0.00
R1241:Mre11a	UTSW	9	14799639	missense	probably damaging	1.00
R2030:Mre11a	UTSW	9	14795805	missense	probably damaging	1.00
R2270:Mre11a	UTSW	9	14815174	missense	probably benign	0.00
R2511:Mre11a	UTSW	9	14795769	critical splice acceptor site	probably null
R2851:Mre11a	UTSW	9	14826547	missense	probably benign	0.00
R2852:Mre11a	UTSW	9	14826547	missense	probably benign	0.00
R2853:Mre11a	UTSW	9	14826547	missense	probably benign	0.00
R3765:Mre11a	UTSW	9	14809847	missense	probably benign	0.25
R4612:Mre11a	UTSW	9	14802903	missense	probably damaging	1.00
R5007:Mre11a	UTSW	9	14809820	missense	probably benign	0.10
R5343:Mre11a	UTSW	9	14811834	missense	probably damaging	0.98
R5679:Mre11a	UTSW	9	14786919	missense	probably damaging	0.99
R5834:Mre11a	UTSW	9	14799657	missense	probably benign	0.15
R5914:Mre11a	UTSW	9	14811936	missense	probably damaging	1.00
R5935:Mre11a	UTSW	9	14786962	missense	probably damaging	1.00
R6089:Mre11a	UTSW	9	14819464	missense	probably benign	0.02
R6393:Mre11a	UTSW	9	14785509	start codon destroyed	probably null	0.00
R6625:Mre11a	UTSW	9	14805391	missense	possibly damaging	0.52
R7248:Mre11a	UTSW	9	14811913	missense	possibly damaging	0.52
R7744:Mre11a	UTSW	9	14809832	missense	possibly damaging	0.94
R7999:Mre11a	UTSW	9	14799669	nonsense	probably null
R8179:Mre11a	UTSW	9	14797066	missense	probably null	1.00
R9293:Mre11a	UTSW	9	14799588	missense	probably damaging	1.00
R9302:Mre11a	UTSW	9	14785530	critical splice donor site	probably null
R9368:Mre11a	UTSW	9	14825218	missense	probably benign
R9410:Mre11a	UTSW	9	14805420	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- GCACAGGGAGTTCCTTTATTTCTCC -3'
(R):5'- AAAACGGAGAGCCCCACTTG -3'

Sequencing Primer
(F):5'- TCCTGATTGCTAAATGGAAAGCGTG -3'
(R):5'- ACTTGAATCCATCATCCTGGTG -3'

Posted On

2014-07-14