Incidental Mutation 'R0739:Gdf2'
ID 70640
Institutional Source Beutler Lab
Gene Symbol Gdf2
Ensembl Gene ENSMUSG00000072625
Gene Name growth differentiation factor 2
Synonyms Bmp9
MMRRC Submission 038920-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R0739 (G1)
Quality Score 216
Status Validated
Chromosome 14
Chromosomal Location 33941039-33947198 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) C to T at 33941221 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Proline to Leucine at position 24 (P24L)
Ref Sequence ENSEMBL: ENSMUSP00000098286 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000100720] [ENSMUST00000168727]
AlphaFold Q9WV56
PDB Structure Pro-bone morphogenetic protein 9 [X-RAY DIFFRACTION]
non-latent pro-bone morphogenetic protein 9 [X-RAY DIFFRACTION]
Predicted Effect probably damaging
Transcript: ENSMUST00000100720
AA Change: P24L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000098286
Gene: ENSMUSG00000072625
AA Change: P24L

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
low complexity region 39 50 N/A INTRINSIC
Pfam:TGFb_propeptide 55 256 8.5e-21 PFAM
TGFB 326 428 3.83e-56 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000168727
SMART Domains Protein: ENSMUSP00000128621
Gene: ENSMUSG00000021943

DomainStartEndE-ValueType
signal peptide 1 29 N/A INTRINSIC
low complexity region 56 67 N/A INTRINSIC
TGFB 374 476 1e-50 SMART
Meta Mutation Damage Score 0.3154 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.8%
  • 10x: 97.4%
  • 20x: 95.0%
Validation Efficiency 98% (48/49)
MGI Phenotype FUNCTION: This gene encodes a secreted ligand of the TGF-beta (transforming growth factor-beta) superfamily of proteins. Ligands of this family bind various TGF-beta receptors leading to recruitment and activation of SMAD family transcription factors that regulate gene expression. The encoded preproprotein is proteolytically processed to generate each subunit of the disulfide-linked homodimer. This protein regulates cartilage and bone development, angiogenesis and differentiation of cholinergic central nervous system neurons. Homozygous null mice exhibit malformations of the vasculature and skeleton. [provided by RefSeq, Jul 2016]
PHENOTYPE: Homozygotes for a null allele show arteriovenous malformations, skeletal anomalies, and abnormal retinal vasculature after anti-BMP10-antibody treatment. Homozygotes for a different null allele show abnormal retinal and tracheal vasculature and tracheal lymphatic vessels after anti-BMP10 treatment. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acsl6 A G 11: 54,337,135 E327G probably damaging Het
Adcy6 T C 15: 98,598,379 D593G probably benign Het
Ankmy1 T C 1: 92,888,648 D248G probably damaging Het
Atp2a1 T C 7: 126,448,256 I743V possibly damaging Het
Axdnd1 T C 1: 156,380,886 N396D possibly damaging Het
Cacna1e C T 1: 154,442,278 A1391T probably damaging Het
Ccr8 G A 9: 120,094,349 G177S probably damaging Het
Clmn C T 12: 104,781,017 G757D possibly damaging Het
Cntn2 T A 1: 132,529,012 I99F probably damaging Het
D6Ertd527e C G 6: 87,111,668 A271G unknown Het
Dnah1 A T 14: 31,265,915 C3515* probably null Het
Eif2d A G 1: 131,154,363 Y64C probably damaging Het
Elovl4 A G 9: 83,785,109 F65S probably damaging Het
F5 G C 1: 164,198,917 R1686P probably damaging Het
Fbn1 T C 2: 125,367,630 E938G probably benign Het
Foxn1 T C 11: 78,358,999 T567A probably benign Het
Gabrr1 T C 4: 33,162,781 M449T probably benign Het
Gm4778 A G 3: 94,265,795 M37V probably benign Het
Itgb3bp T C 4: 99,802,196 I29V probably benign Het
Kcnk7 C T 19: 5,704,802 probably null Het
Klf11 T C 12: 24,660,248 S432P probably damaging Het
Neo1 C T 9: 58,921,877 A580T probably benign Het
Nexmif G T X: 104,084,949 Q1121K probably benign Het
Olfr486 T C 7: 108,172,010 T245A probably benign Het
Olfr561 T C 7: 102,774,665 I47T probably damaging Het
Olfr611 T C 7: 103,517,724 Y220C probably damaging Het
Osgepl1 G T 1: 53,323,195 E399* probably null Het
Parvg T A 15: 84,331,021 V197E probably damaging Het
Pcyt2 A G 11: 120,612,044 L257P probably damaging Het
Pou3f2 T C 4: 22,486,960 D391G possibly damaging Het
Psmd2 C T 16: 20,655,329 R261C probably benign Het
Ptpn13 T C 5: 103,575,132 F1981L probably benign Het
Rbp3 A T 14: 33,958,647 I1069F probably benign Het
Rhbdf2 A T 11: 116,600,161 L655Q probably damaging Het
Sec16a A T 2: 26,441,051 N317K possibly damaging Het
Serpina3f T C 12: 104,218,353 V252A probably damaging Het
Slc22a23 C T 13: 34,344,383 G139S possibly damaging Het
Smyd2 T C 1: 189,888,862 T220A possibly damaging Het
Snrpb2 T A 2: 143,065,361 probably benign Het
Sptan1 A T 2: 30,013,518 I1502F probably damaging Het
Srprb A T 9: 103,197,595 L116H probably damaging Het
Stradb T A 1: 58,977,015 probably benign Het
Tm9sf4 C A 2: 153,203,814 F535L probably damaging Het
Tmprss15 A T 16: 79,024,848 S440T possibly damaging Het
Tpr C T 1: 150,407,497 A293V possibly damaging Het
Usp34 C T 11: 23,467,243 T2964I possibly damaging Het
Usp35 C A 7: 97,311,667 E851* probably null Het
Zc3h14 T A 12: 98,757,201 V250D probably damaging Het
Zfp568 T A 7: 30,023,321 C564S probably damaging Het
Other mutations in Gdf2
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0557:Gdf2 UTSW 14 33941221 missense probably damaging 1.00
R0631:Gdf2 UTSW 14 33941221 missense probably damaging 1.00
R2142:Gdf2 UTSW 14 33945241 missense probably benign
R2292:Gdf2 UTSW 14 33945188 missense possibly damaging 0.60
R3615:Gdf2 UTSW 14 33944957 missense probably damaging 1.00
R3616:Gdf2 UTSW 14 33944957 missense probably damaging 1.00
R3974:Gdf2 UTSW 14 33944834 missense probably damaging 0.97
R3975:Gdf2 UTSW 14 33944834 missense probably damaging 0.97
R3976:Gdf2 UTSW 14 33944834 missense probably damaging 0.97
R4665:Gdf2 UTSW 14 33945451 missense probably damaging 1.00
R5007:Gdf2 UTSW 14 33944906 missense probably benign 0.02
R5227:Gdf2 UTSW 14 33941494 critical splice donor site probably null
R5253:Gdf2 UTSW 14 33945307 missense probably benign 0.14
R5259:Gdf2 UTSW 14 33944831 missense probably benign 0.01
R6286:Gdf2 UTSW 14 33945100 missense probably damaging 1.00
R7644:Gdf2 UTSW 14 33944890 missense probably benign 0.00
R8472:Gdf2 UTSW 14 33944840 missense probably damaging 1.00
R9067:Gdf2 UTSW 14 33941454 missense probably benign 0.20
R9525:Gdf2 UTSW 14 33945607 makesense probably null
Z1177:Gdf2 UTSW 14 33945317 missense probably damaging 0.97
Predicted Primers PCR Primer
(F):5'- ATAAGAGGTCCGAGCAGAGCATCC -3'
(R):5'- ACTATACCTTCCACGCTGAAGCTCC -3'

Sequencing Primer
(F):5'- CCGTGAGACAGCCAAAGTC -3'
(R):5'- TACAAGTCGATCATGTACTGGG -3'
Posted On 2013-09-30