Incidental Mutation 'R0739:Axdnd1'
ID70605
Institutional Source Beutler Lab
Gene Symbol Axdnd1
Ensembl Gene ENSMUSG00000026601
Gene Nameaxonemal dynein light chain domain containing 1
SynonymsLOC381304, 9430070O13Rik
MMRRC Submission 038920-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.148) question?
Stock #R0739 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location156323509-156421159 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 156380886 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Aspartic acid at position 396 (N396D)
Ref Sequence ENSEMBL: ENSMUSP00000135900 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000177824] [ENSMUST00000178036] [ENSMUST00000213088]
Predicted Effect noncoding transcript
Transcript: ENSMUST00000027895
Predicted Effect possibly damaging
Transcript: ENSMUST00000177824
AA Change: N396D

PolyPhen 2 Score 0.729 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000135900
Gene: ENSMUSG00000026601
AA Change: N396D

DomainStartEndE-ValueType
Pfam:Ax_dynein_light 131 314 2.4e-12 PFAM
low complexity region 405 414 N/A INTRINSIC
low complexity region 452 464 N/A INTRINSIC
low complexity region 666 677 N/A INTRINSIC
coiled coil region 787 837 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000178036
AA Change: N461D

PolyPhen 2 Score 0.514 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000137354
Gene: ENSMUSG00000026601
AA Change: N461D

DomainStartEndE-ValueType
Pfam:Ax_dynein_light 196 380 3.3e-14 PFAM
low complexity region 470 479 N/A INTRINSIC
low complexity region 517 529 N/A INTRINSIC
low complexity region 731 742 N/A INTRINSIC
coiled coil region 889 939 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000179572
Predicted Effect unknown
Transcript: ENSMUST00000180173
AA Change: N264D
Predicted Effect probably benign
Transcript: ENSMUST00000213088
AA Change: N461D

PolyPhen 2 Score 0.010 (Sensitivity: 0.96; Specificity: 0.77)
Meta Mutation Damage Score 0.1079 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.8%
  • 10x: 97.4%
  • 20x: 95.0%
Validation Efficiency 98% (48/49)
MGI Phenotype Mice homozygous for disruptions in this gene display kidney glomerular defects leading to blood and urine chemistry abnormalities. Death usually occurs before 5 weeks of age.,NO_PHENOTYPE
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acsl6 A G 11: 54,337,135 E327G probably damaging Het
Adcy6 T C 15: 98,598,379 D593G probably benign Het
Ankmy1 T C 1: 92,888,648 D248G probably damaging Het
Atp2a1 T C 7: 126,448,256 I743V possibly damaging Het
Cacna1e C T 1: 154,442,278 A1391T probably damaging Het
Ccr8 G A 9: 120,094,349 G177S probably damaging Het
Clmn C T 12: 104,781,017 G757D possibly damaging Het
Cntn2 T A 1: 132,529,012 I99F probably damaging Het
D6Ertd527e C G 6: 87,111,668 A271G unknown Het
Dnah1 A T 14: 31,265,915 C3515* probably null Het
Eif2d A G 1: 131,154,363 Y64C probably damaging Het
Elovl4 A G 9: 83,785,109 F65S probably damaging Het
F5 G C 1: 164,198,917 R1686P probably damaging Het
Fbn1 T C 2: 125,367,630 E938G probably benign Het
Foxn1 T C 11: 78,358,999 T567A probably benign Het
Gabrr1 T C 4: 33,162,781 M449T probably benign Het
Gdf2 C T 14: 33,941,221 P24L probably damaging Het
Gm4778 A G 3: 94,265,795 M37V probably benign Het
Itgb3bp T C 4: 99,802,196 I29V probably benign Het
Kcnk7 C T 19: 5,704,802 probably null Het
Klf11 T C 12: 24,660,248 S432P probably damaging Het
Neo1 C T 9: 58,921,877 A580T probably benign Het
Nexmif G T X: 104,084,949 Q1121K probably benign Het
Olfr486 T C 7: 108,172,010 T245A probably benign Het
Olfr561 T C 7: 102,774,665 I47T probably damaging Het
Olfr611 T C 7: 103,517,724 Y220C probably damaging Het
Osgepl1 G T 1: 53,323,195 E399* probably null Het
Parvg T A 15: 84,331,021 V197E probably damaging Het
Pcyt2 A G 11: 120,612,044 L257P probably damaging Het
Pou3f2 T C 4: 22,486,960 D391G possibly damaging Het
Psmd2 C T 16: 20,655,329 R261C probably benign Het
Ptpn13 T C 5: 103,575,132 F1981L probably benign Het
Rbp3 A T 14: 33,958,647 I1069F probably benign Het
Rhbdf2 A T 11: 116,600,161 L655Q probably damaging Het
Sec16a A T 2: 26,441,051 N317K possibly damaging Het
Serpina3f T C 12: 104,218,353 V252A probably damaging Het
Slc22a23 C T 13: 34,344,383 G139S possibly damaging Het
Smyd2 T C 1: 189,888,862 T220A possibly damaging Het
Snrpb2 T A 2: 143,065,361 probably benign Het
Sptan1 A T 2: 30,013,518 I1502F probably damaging Het
Srprb A T 9: 103,197,595 L116H probably damaging Het
Stradb T A 1: 58,977,015 probably benign Het
Tm9sf4 C A 2: 153,203,814 F535L probably damaging Het
Tmprss15 A T 16: 79,024,848 S440T possibly damaging Het
Tpr C T 1: 150,407,497 A293V possibly damaging Het
Usp34 C T 11: 23,467,243 T2964I possibly damaging Het
Usp35 C A 7: 97,311,667 E851* probably null Het
Zc3h14 T A 12: 98,757,201 V250D probably damaging Het
Zfp568 T A 7: 30,023,321 C564S probably damaging Het
Other mutations in Axdnd1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03058:Axdnd1 APN 1 156376663 missense probably benign 0.41
IGL03075:Axdnd1 APN 1 156395442 missense probably damaging 1.00
IGL03165:Axdnd1 APN 1 156378389 missense probably benign 0.00
R0164:Axdnd1 UTSW 1 156378386 missense possibly damaging 0.93
R0164:Axdnd1 UTSW 1 156378386 missense possibly damaging 0.93
R1087:Axdnd1 UTSW 1 156365689 missense probably benign 0.08
R1350:Axdnd1 UTSW 1 156378380 critical splice donor site probably null
R1488:Axdnd1 UTSW 1 156348960 missense probably damaging 1.00
R1493:Axdnd1 UTSW 1 156346701 missense probably benign 0.03
R1845:Axdnd1 UTSW 1 156376544 missense possibly damaging 0.58
R1900:Axdnd1 UTSW 1 156380774 splice site probably null
R2126:Axdnd1 UTSW 1 156333214 missense probably benign 0.03
R2163:Axdnd1 UTSW 1 156392003 missense probably damaging 1.00
R2169:Axdnd1 UTSW 1 156418309 missense probably damaging 1.00
R2380:Axdnd1 UTSW 1 156365651 missense probably benign 0.02
R2568:Axdnd1 UTSW 1 156392749 missense possibly damaging 0.90
R3052:Axdnd1 UTSW 1 156341870 missense probably damaging 0.96
R3053:Axdnd1 UTSW 1 156341870 missense probably damaging 0.96
R3767:Axdnd1 UTSW 1 156380858 missense probably damaging 1.00
R3927:Axdnd1 UTSW 1 156419270 missense probably damaging 1.00
R3936:Axdnd1 UTSW 1 156331639 missense probably benign 0.01
R4829:Axdnd1 UTSW 1 156376646 missense possibly damaging 0.93
R4882:Axdnd1 UTSW 1 156395559 splice site probably null
R4969:Axdnd1 UTSW 1 156395505 missense possibly damaging 0.95
R5091:Axdnd1 UTSW 1 156420410 missense possibly damaging 0.83
R5510:Axdnd1 UTSW 1 156335350 missense probably benign 0.03
R5549:Axdnd1 UTSW 1 156398534 missense probably damaging 1.00
R5587:Axdnd1 UTSW 1 156351412 missense probably damaging 1.00
R5792:Axdnd1 UTSW 1 156341889 missense probably damaging 0.99
R5840:Axdnd1 UTSW 1 156348958 missense probably damaging 1.00
R6187:Axdnd1 UTSW 1 156365612 splice site probably null
R6208:Axdnd1 UTSW 1 156392856 intron probably benign
R6369:Axdnd1 UTSW 1 156392745 missense probably damaging 1.00
R6493:Axdnd1 UTSW 1 156380813 missense probably damaging 1.00
R7014:Axdnd1 UTSW 1 156330962 intron probably null
R7115:Axdnd1 UTSW 1 156380876 missense
R7203:Axdnd1 UTSW 1 156382389 missense probably damaging 0.98
R7352:Axdnd1 UTSW 1 156382477 missense possibly damaging 0.91
R7447:Axdnd1 UTSW 1 156418232 critical splice donor site probably null
R7470:Axdnd1 UTSW 1 156376516 missense
R7686:Axdnd1 UTSW 1 156395464 nonsense probably null
R7793:Axdnd1 UTSW 1 156338743 critical splice donor site probably null
R7809:Axdnd1 UTSW 1 156392801 nonsense probably null
R7882:Axdnd1 UTSW 1 156397453 missense
R7965:Axdnd1 UTSW 1 156397453 missense
X0009:Axdnd1 UTSW 1 156388079 missense possibly damaging 0.61
X0067:Axdnd1 UTSW 1 156376535 missense possibly damaging 0.67
Z1176:Axdnd1 UTSW 1 156349063 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGGTCCTTTCCAAACAGTGCTCTG -3'
(R):5'- TGGGCAAAGGGAAAATCCTCGTTC -3'

Sequencing Primer
(F):5'- AGTGCTCTGGACCAGCAATG -3'
(R):5'- CGTTCCTAATCCATGTAGCACAG -3'
Posted On2013-09-30