Incidental Mutation 'R0743:Olfr1100'
List |< first << previous [record 26 of 58] next >> last >|
ID70757
Institutional Source Beutler Lab
Gene Symbol Olfr1100
Ensembl Gene ENSMUSG00000070875
Gene Nameolfactory receptor 1100
SynonymsGA_x6K02T2Q125-48465387-48464422, MOR206-4
MMRRC Submission 038924-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.088) question?
Stock #R0743 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location86976029-86979954 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 86978499 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Isoleucine at position 99 (T99I)
Ref Sequence ENSEMBL: ENSMUSP00000151088 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000094913] [ENSMUST00000117211]
Predicted Effect probably benign
Transcript: ENSMUST00000094913
AA Change: T99I

PolyPhen 2 Score 0.117 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000092517
Gene: ENSMUSG00000070875
AA Change: T99I

DomainStartEndE-ValueType
Pfam:7tm_4 31 308 1.7e-51 PFAM
Pfam:7tm_1 41 314 2.3e-19 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000117211
AA Change: T99I

PolyPhen 2 Score 0.117 (Sensitivity: 0.93; Specificity: 0.86)
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 96.7%
  • 20x: 92.7%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc4 A T 14: 118,553,288 I844N possibly damaging Het
Bend7 A T 2: 4,744,244 K57N probably damaging Het
Cacna2d4 C T 6: 119,307,286 R745W probably damaging Het
Csmd2 A T 4: 128,113,676 T149S probably benign Het
Cyp2a12 T C 7: 27,032,542 I236T probably benign Het
Dnase1l2 A G 17: 24,441,880 V170A possibly damaging Het
Dnm2 T A 9: 21,500,265 Y597N probably damaging Het
Epsti1 A T 14: 77,931,275 R117S probably damaging Het
Gabarapl2 A T 8: 111,942,505 I32F probably damaging Het
Glrb T A 3: 80,879,680 I59F probably damaging Het
Gm13089 A T 4: 143,698,564 I103N probably damaging Het
Gm17689 T C 9: 36,581,301 S103G probably benign Het
Gosr1 A G 11: 76,730,146 I239T probably benign Het
Kif5b G T 18: 6,209,192 R857S probably damaging Het
Kmt5a C A 5: 124,447,219 N44K probably damaging Het
Ksr1 A T 11: 79,021,503 H675Q possibly damaging Het
Maats1 A G 16: 38,335,634 F76L possibly damaging Het
Mep1b A G 18: 21,080,458 D68G possibly damaging Het
Nebl A C 2: 17,411,118 S327A probably benign Het
Nfat5 G A 8: 107,368,066 E962K probably damaging Het
Nfatc4 A C 14: 55,826,644 D126A probably damaging Het
Nmt2 A T 2: 3,314,785 R271* probably null Het
Nol7 G A 13: 43,400,615 V133I probably benign Het
Npepps A G 11: 97,206,058 probably benign Het
Nphp3 GCATCATCATCATCATC GCATCATCATCATC 9: 104,022,768 probably benign Het
Olfr376 A T 11: 73,374,889 I47F probably benign Het
Olfr610 C T 7: 103,506,862 W28* probably null Het
Olfr798 T A 10: 129,625,843 T73S probably benign Het
Ovgp1 T A 3: 105,974,932 L37H probably damaging Het
Padi3 G T 4: 140,786,429 A646D probably benign Het
Pamr1 A G 2: 102,609,907 E142G probably damaging Het
Papolg A T 11: 23,870,818 probably null Het
Pfkl C T 10: 77,995,243 probably null Het
Plrg1 T C 3: 83,059,917 S132P probably benign Het
Prr14l C A 5: 32,831,194 C319F possibly damaging Het
Prtn3 T A 10: 79,879,677 M1K probably null Het
Ptpn22 T C 3: 103,902,171 F700S probably damaging Het
Ptprz1 C T 6: 23,044,367 Q1273* probably null Het
Rif1 GCCACCA GCCA 2: 52,110,324 probably benign Het
Ryr2 T C 13: 11,554,529 D4963G probably damaging Het
Sec16a G A 2: 26,419,722 L2091F possibly damaging Het
Senp6 C T 9: 80,093,589 R27C probably damaging Het
Shcbp1 T A 8: 4,764,906 M191L probably benign Het
Sirt4 T C 5: 115,482,955 K53E probably benign Het
Slc10a2 A G 8: 5,089,132 S271P probably damaging Het
Slc35b2 T A 17: 45,566,825 F293I probably damaging Het
Slc38a10 C T 11: 120,140,643 V103M probably damaging Het
St5 A G 7: 109,557,345 L66P probably damaging Het
Stab2 T A 10: 86,887,895 I1479F probably damaging Het
Synpo2 A G 3: 123,112,706 V987A probably benign Het
Syt9 A G 7: 107,436,561 I262V probably damaging Het
Taf2 GCTTCTTCTTCTTCTTCTT GCTTCTTCTTCTTCTT 15: 55,016,461 probably benign Het
Tmem39a A T 16: 38,585,402 I200F probably damaging Het
Ttn G A 2: 76,749,269 T23760M probably damaging Het
Uqcrc1 C T 9: 108,944,705 Q22* probably null Het
Wdtc1 A G 4: 133,300,661 W377R probably damaging Het
Zfp454 A G 11: 50,873,937 S223P probably benign Het
Other mutations in Olfr1100
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02387:Olfr1100 APN 2 86977849 nonsense probably null
R0102:Olfr1100 UTSW 2 86978205 missense possibly damaging 0.90
R0477:Olfr1100 UTSW 2 86978223 missense probably damaging 0.99
R0586:Olfr1100 UTSW 2 86978782 missense probably damaging 0.99
R1163:Olfr1100 UTSW 2 86978676 missense probably damaging 1.00
R1640:Olfr1100 UTSW 2 86978619 missense probably damaging 1.00
R2865:Olfr1100 UTSW 2 86978461 missense possibly damaging 0.56
R4478:Olfr1100 UTSW 2 86978218 missense probably benign
R4548:Olfr1100 UTSW 2 86978670 missense probably damaging 0.98
R4618:Olfr1100 UTSW 2 86978274 missense possibly damaging 0.87
R4829:Olfr1100 UTSW 2 86978574 missense probably damaging 0.99
R4858:Olfr1100 UTSW 2 86978349 missense probably damaging 1.00
R5071:Olfr1100 UTSW 2 86978322 missense possibly damaging 0.88
R5072:Olfr1100 UTSW 2 86978322 missense possibly damaging 0.88
R5073:Olfr1100 UTSW 2 86978322 missense possibly damaging 0.88
R5074:Olfr1100 UTSW 2 86978322 missense possibly damaging 0.88
R5574:Olfr1100 UTSW 2 86978523 missense probably benign 0.00
R5735:Olfr1100 UTSW 2 86978700 missense probably benign 0.08
R5874:Olfr1100 UTSW 2 86978442 missense probably damaging 0.99
R6228:Olfr1100 UTSW 2 86978691 missense probably damaging 1.00
R6689:Olfr1100 UTSW 2 86978154 missense probably benign 0.36
R6979:Olfr1100 UTSW 2 86978233 missense probably damaging 1.00
R7006:Olfr1100 UTSW 2 86977959 missense probably damaging 0.99
R7274:Olfr1100 UTSW 2 86978523 missense probably benign 0.00
R7399:Olfr1100 UTSW 2 86978157 missense probably benign 0.19
R7560:Olfr1100 UTSW 2 86978778 missense probably benign 0.00
R7765:Olfr1100 UTSW 2 86978194 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- GAAAACAGAAGCCACTTGTTCCTTTCC -3'
(R):5'- CGCAGGCATGATGCTGATCATTCG -3'

Sequencing Primer
(F):5'- TGTATCACTGCAAGACAGTGC -3'
(R):5'- TAGATGCTCAGCTTCACACTCC -3'
Posted On2013-09-30