Incidental Mutation 'R9401:Fzd8'
ID 711257
Institutional Source Beutler Lab
Gene Symbol Fzd8
Ensembl Gene ENSMUSG00000036904
Gene Name frizzled class receptor 8
Synonyms mFZ8, Fz8
MMRRC Submission
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R9401 (G1)
Quality Score 225.009
Status Not validated
Chromosome 18
Chromosomal Location 9212856-9216201 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to A at 9213205 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Cysteine to Serine at position 96 (C96S)
Ref Sequence ENSEMBL: ENSMUSP00000039660 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000041080]
AlphaFold Q61091
PDB Structure CRYSTAL STRUCTURE OF THE CYSTEINE-RICH DOMAIN OF MOUSE FRIZZLED 8 (MFZ8) [X-RAY DIFFRACTION]
Crystal structure of XWnt8 in complex with the cysteine-rich domain of Frizzled 8 [X-RAY DIFFRACTION]
Predicted Effect possibly damaging
Transcript: ENSMUST00000041080
AA Change: C96S

PolyPhen 2 Score 0.783 (Sensitivity: 0.85; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000039660
Gene: ENSMUSG00000036904
AA Change: C96S

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
FRI 34 153 9.06e-73 SMART
low complexity region 161 228 N/A INTRINSIC
Frizzled 264 621 1.47e-219 SMART
low complexity region 624 655 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This intronless gene is a member of the frizzled gene family. Members of this family encode seven-transmembrane domain proteins that are receptors for the Wingless type MMTV integration site family of signaling proteins. Most frizzled receptors are coupled to the beta-catenin canonical signaling pathway. This gene is highly expressed in two human cancer cell lines, indicating that it may play a role in several types of cancer. The crystal structure of the extracellular cysteine-rich domain of a similar mouse protein has been determined. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mutation of this gene does not appear to result in a phenotype. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 74 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700014D04Rik T C 13: 59,742,198 T603A probably benign Het
Aars A G 8: 111,054,153 D850G probably benign Het
Abcc9 T A 6: 142,598,110 T1480S possibly damaging Het
Adgrb3 C A 1: 25,553,702 V335F probably damaging Het
Agfg1 C A 1: 82,882,237 A275D probably benign Het
Alms1 T A 6: 85,678,019 C2713* probably null Het
Atp8a1 G A 5: 67,749,149 A474V Het
Baz1a C A 12: 54,916,554 S918I probably damaging Het
Bcl2l12 G T 7: 44,994,250 T120K possibly damaging Het
Bcl6 G T 16: 23,972,357 Q416K possibly damaging Het
Cdhr1 T A 14: 37,098,098 I16F probably benign Het
Celsr1 G T 15: 86,033,085 S229* probably null Het
Cilp T C 9: 65,278,099 V492A probably damaging Het
Crim1 CCGC CC 17: 78,350,865 probably null Het
Ctcfl T G 2: 173,106,088 T479P probably damaging Het
Dlx6 A C 6: 6,863,581 M68L probably benign Het
Dnah7a C A 1: 53,528,867 V1857F probably benign Het
Dpy19l4 A G 4: 11,265,806 V714A probably benign Het
Elovl7 T A 13: 108,282,654 N273K probably benign Het
Fbxo22 A G 9: 55,223,344 K299R probably benign Het
Fig4 A G 10: 41,267,737 V242A probably benign Het
Fmo9 A T 1: 166,677,620 M68K probably damaging Het
Fry T A 5: 150,378,938 Y537N probably damaging Het
Fryl C T 5: 73,065,220 W2006* probably null Het
Gm40460 ACCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAG ACCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAG 7: 142,240,713 probably benign Het
Gm4450 T G 3: 98,456,503 T9P probably damaging Het
Gspt1 T C 16: 11,232,671 D272G possibly damaging Het
Gzmf A T 14: 56,211,356 M1K probably null Het
Hipk1 T C 3: 103,777,979 T107A probably benign Het
Ighe C T 12: 113,269,487 C438Y Het
Igkv4-50 T A 6: 69,700,983 R46W Het
Igsf3 T A 3: 101,425,759 Y118N probably damaging Het
Ispd T C 12: 36,502,074 V309A probably benign Het
Itsn1 T A 16: 91,815,520 Y266N probably damaging Het
Jph3 A G 8: 121,785,115 E614G probably damaging Het
Klk1b8 T A 7: 43,954,250 D170E probably benign Het
Ly6e A T 15: 74,958,304 K36* probably null Het
Map3k6 C A 4: 133,241,156 A23E probably damaging Het
Med13l T A 5: 118,745,024 M1316K probably benign Het
Olfr1038-ps A T 2: 86,122,024 I34F possibly damaging Het
Olfr368 T C 2: 37,332,281 V178A possibly damaging Het
Olfr813 A G 10: 129,857,429 R304G probably benign Het
Pih1d2 T A 9: 50,618,605 C45S probably damaging Het
Pik3r2 G A 8: 70,771,093 S318L possibly damaging Het
Pknox1 T C 17: 31,583,778 I9T probably benign Het
Pknox2 T C 9: 36,923,745 I143V probably damaging Het
Polr1d A G 5: 147,078,678 Y57C probably damaging Het
Pum3 A T 19: 27,398,936 D527E probably benign Het
Rars2 T A 4: 34,654,819 H374Q probably damaging Het
Rassf9 G A 10: 102,512,508 probably benign Het
Rbl1 T A 2: 157,174,822 H619L possibly damaging Het
Scamp4 T C 10: 80,612,404 V153A probably benign Het
Sec23b T G 2: 144,578,366 I450S probably benign Het
Slc35b2 A G 17: 45,566,984 I297V probably benign Het
Slc4a4 C T 5: 89,179,666 T654I probably damaging Het
Slc6a5 T A 7: 49,951,437 M662K probably damaging Het
Smarcad1 T C 6: 65,094,337 Y589H probably benign Het
Stab1 A T 14: 31,161,112 F374I probably benign Het
Stat5a C T 11: 100,865,428 T158M possibly damaging Het
Trpc3 A T 3: 36,621,354 Y878* probably null Het
Ubr1 T A 2: 120,935,284 T491S probably benign Het
Uggt1 C T 1: 36,216,131 probably null Het
Ugt1a6a T A 1: 88,139,160 Y229* probably null Het
Vmn1r225 G A 17: 20,502,649 W117* probably null Het
Vmn1r225 A C 17: 20,502,650 K118Q probably damaging Het
Vmn1r43 G A 6: 89,869,895 T203M probably damaging Het
Vmn2r116 T C 17: 23,401,592 S767P probably damaging Het
Wdr90 AGAC AGACGAC 17: 25,845,776 probably benign Het
Ythdf3 C T 3: 16,204,495 P280S probably damaging Het
Zbbx A G 3: 75,112,083 S107P probably benign Het
Zdhhc7 A T 8: 120,086,686 V128E probably benign Het
Zfp235 A G 7: 24,142,126 S657G probably damaging Het
Zfp442 T A 2: 150,409,695 I96F possibly damaging Het
Zfp84 G A 7: 29,776,872 E330K probably damaging Het
Other mutations in Fzd8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00571:Fzd8 APN 18 9213068 missense unknown
IGL01511:Fzd8 APN 18 9213293 missense unknown
IGL03129:Fzd8 APN 18 9214270 missense probably damaging 1.00
Stilt UTSW 18 9213880 missense probably damaging 1.00
R0058:Fzd8 UTSW 18 9213985 missense possibly damaging 0.92
R0715:Fzd8 UTSW 18 9212947 missense unknown
R0966:Fzd8 UTSW 18 9214745 missense probably damaging 0.99
R1717:Fzd8 UTSW 18 9214364 missense probably damaging 1.00
R1751:Fzd8 UTSW 18 9213643 missense probably damaging 0.98
R1761:Fzd8 UTSW 18 9213643 missense probably damaging 0.98
R1905:Fzd8 UTSW 18 9213803 missense probably damaging 1.00
R1956:Fzd8 UTSW 18 9214502 missense probably damaging 1.00
R2892:Fzd8 UTSW 18 9214514 missense probably damaging 1.00
R3897:Fzd8 UTSW 18 9214939 missense possibly damaging 0.89
R3968:Fzd8 UTSW 18 9214070 missense probably damaging 0.98
R4934:Fzd8 UTSW 18 9214492 frame shift probably null
R5366:Fzd8 UTSW 18 9213880 missense probably damaging 1.00
R5624:Fzd8 UTSW 18 9213268 missense unknown
R6261:Fzd8 UTSW 18 9214598 missense possibly damaging 0.61
R6757:Fzd8 UTSW 18 9213238 missense possibly damaging 0.78
R6758:Fzd8 UTSW 18 9213238 missense possibly damaging 0.78
R6899:Fzd8 UTSW 18 9214729 missense probably damaging 0.98
R7242:Fzd8 UTSW 18 9214171 missense probably damaging 1.00
R8140:Fzd8 UTSW 18 9213797 missense probably damaging 1.00
R8324:Fzd8 UTSW 18 9214688 missense probably damaging 1.00
R8722:Fzd8 UTSW 18 9213686 missense possibly damaging 0.67
R8818:Fzd8 UTSW 18 9214474 missense probably benign 0.26
R8820:Fzd8 UTSW 18 9213247 missense unknown
R8913:Fzd8 UTSW 18 9213869 missense probably damaging 1.00
R9036:Fzd8 UTSW 18 9214661 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTGGAAGTGACCTCGCTCCTAG -3'
(R):5'- AGTCCATGCACAGAGTGTC -3'

Sequencing Primer
(F):5'- TGCCAAGAGATCACGGTGC -3'
(R):5'- ACAGAGTGTCCGGGTTGC -3'
Posted On 2022-05-16