Mutagenetix > Incidental Mutation

Incidental Mutation 'R9765:Slc30a4'

733187

Institutional Source

Beutler Lab

Gene Symbol

Slc30a4

Ensembl Gene

ENSMUSG00000005802

Gene Name

solute carrier family 30 (zinc transporter), member 4

Synonyms

Znt4

MMRRC Submission

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R9765 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

122681233-122702663 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 122694536 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Tyrosine to Asparagine at position 133 (Y133N)

Ref Sequence

ENSEMBL: ENSMUSP00000005952 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000005952] [ENSMUST00000099457]

AlphaFold

O35149

Predicted Effect

probably damaging
Transcript: ENSMUST00000005952
AA Change: Y133N

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)

SMART Domains

Protein: ENSMUSP00000005952
Gene: ENSMUSG00000005802
AA Change: Y133N

Domain	Start	End	E-Value	Type
low complexity region	67	83	N/A	INTRINSIC
Pfam:Cation_efflux	114	333	1.3e-55	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000099457

SMART Domains

Protein: ENSMUSP00000097056
Gene: ENSMUSG00000005802

Domain	Start	End	E-Value	Type
low complexity region	67	83	N/A	INTRINSIC
Pfam:Cation_efflux	124	368	4.6e-46	PFAM

Coding Region Coverage

1x: 99.9%
3x: 99.7%
10x: 99.3%
20x: 98.6%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Zinc is the second most abundant trace metal in the human body. It is an essential element, serving both a structural role, as in the formation of zinc fingers in DNA-binding proteins, and a catalytic role in metalloenzymes, such as pancreatic carboxypeptidases (e.g., MIM 114852), alkaline phosphatases (e.g., MIM 171760), various dehydrogenases, and superoxide dismutases (e.g., MIM 147450). SLC30A4, or ZNT4, belongs to the ZNT family of zinc transporters. ZNTs are involved in transporting zinc out of the cytoplasm and have similar structures, consisting of 6 transmembrane domains and a histidine-rich cytoplasmic loop (Huang and Gitschier, 1997 [PubMed 9354792]).[supplied by OMIM, Mar 2008]
PHENOTYPE: Homozygous mutant dams produce zinc-deficient milk that is lethal to all nursing pups. Pleiotropic defects observed in mutant males and females include otolith degeneration, impaired motor coordination, alopecia, and dermatitis. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 67 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930505A04Rik	C	T	11: 30,454,829	V25I	probably benign	Het
Actr1b	T	A	1: 36,702,596	H65L	probably benign	Het
Adgrf5	G	A	17: 43,437,600	G440E	probably damaging	Het
Ash1l	T	A	3: 89,023,193	D1992E	probably damaging	Het
Cacng4	A	G	11: 107,741,983	F81S	probably damaging	Het
Cdca8	A	G	4: 124,920,329	I223T	probably benign	Het
Cdh19	A	G	1: 110,895,381		probably null	Het
Ces2f	A	G	8: 104,950,046	D124G	probably damaging	Het
Cks1brt	A	G	8: 85,171,605	Y29C	probably damaging	Het
Cntnap4	T	C	8: 112,757,478	S388P	probably benign	Het
Cntnap4	T	C	8: 112,841,864	I844T	probably damaging	Het
Col4a3	G	A	1: 82,668,957	W396*	probably null	Het
Cul9	A	T	17: 46,539,298	S449T	probably benign	Het
Cux2	G	A	5: 121,869,132	P822L	probably benign	Het
Cyp3a13	G	C	5: 137,911,621	P147A	probably damaging	Het
Dennd2a	C	T	6: 39,496,973		probably null	Het
Dgkg	T	C	16: 22,479,407	M743V	possibly damaging	Het
Dhx35	C	T	2: 158,829,581	R311W	probably benign	Het
Dnase1l2	A	T	17: 24,441,075	V273E	probably damaging	Het
Dock8	T	G	19: 25,169,468	I1437S	possibly damaging	Het
Dpy19l3	T	C	7: 35,708,631	D450G	probably benign	Het
Dsg4	G	A	18: 20,471,277	V934I	probably benign	Het
Eef2	T	A	10: 81,179,176	F236L	possibly damaging	Het
Eml4	A	G	17: 83,440,069	I247V	probably damaging	Het
Evi5	A	C	5: 107,799,254	C451G	probably benign	Het
Fam124a	T	G	14: 62,587,434	W126G	probably damaging	Het
Fbxw21	A	G	9: 109,146,557	I257T	possibly damaging	Het
Fn3krp	A	G	11: 121,421,478	K6E	probably benign	Het
Gcn1l1	G	A	5: 115,597,072	W1149*	probably null	Het
Glud1	C	T	14: 34,338,838	R453*	probably null	Het
Gtf2f1	G	A	17: 57,011,125		probably benign	Het
Gtpbp4	T	A	13: 8,974,958	D532V	probably benign	Het
Ifnar2	G	A	16: 91,388,087	R122H	possibly damaging	Het
Ipo11	A	G	13: 106,925,048	W35R	probably damaging	Het
Iqgap3	G	A	3: 88,110,054	R1115Q	possibly damaging	Het
Kifc5b	A	G	17: 26,923,265	E239G	probably damaging	Het
Map3k7	A	T	4: 32,019,519	E553D	probably damaging	Het
Mdh1	G	T	11: 21,562,926	S146*	probably null	Het
Muc16	C	A	9: 18,637,198	W5933L	probably benign	Het
Myo16	C	A	8: 10,570,401	P1651T	probably damaging	Het
Naip5	C	G	13: 100,230,761	A276P	probably damaging	Het
Noxo1	G	T	17: 24,696,412		probably benign	Het
Olfr1299	T	A	2: 111,664,885	Y220N	probably benign	Het
Pcdhgb6	A	T	18: 37,743,001	N254I	possibly damaging	Het
Peli3	A	T	19: 4,941,822	C30*	probably null	Het
Plb1	T	A	5: 32,355,387	M1363K	probably damaging	Het
Ppp4r4	G	T	12: 103,584,087	E257*	probably null	Het
Rbm20	T	G	19: 53,851,629	S1016R	probably benign	Het
Rcn1	A	T	2: 105,394,681	L143Q	possibly damaging	Het
Retreg1	G	A	15: 25,940,899	G3D	unknown	Het
Rrm2	A	G	12: 24,708,957	N65D	probably benign	Het
Samhd1	G	T	2: 157,123,299	H199N	probably damaging	Het
Slain2	T	A	5: 72,957,626	L400*	probably null	Het
Slc26a7	A	T	4: 14,522,862	M486K	probably benign	Het
Spef2	A	T	15: 9,601,859	F1439Y	unknown	Het
Srpr	T	C	9: 35,211,374	V29A	possibly damaging	Het
St3gal1	T	C	15: 67,109,650	T226A	possibly damaging	Het
Tas2r136	T	A	6: 132,777,850	I105F	probably benign	Het
Tmem208	A	G	8: 105,334,874	*177W	probably null	Het
Ttc30b	A	T	2: 75,938,123	Y95*	probably null	Het
Utrn	T	A	10: 12,735,177	N478I	probably damaging	Het
Zbtb37	T	C	1: 161,031,862	Y291C	probably damaging	Het
Zc3h3	T	G	15: 75,837,610	H470P	probably benign	Het
Zfp40	A	T	17: 23,176,889	Y241*	probably null	Het
Zfp457	T	C	13: 67,292,810	N567S	probably benign	Het
Zfp458	C	T	13: 67,260,153	V33M	probably damaging	Het
Zfp953	A	T	13: 67,343,414	I158N	possibly damaging	Het

Other mutations in Slc30a4

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01524:Slc30a4	APN	2	122702388	missense	possibly damaging	0.87
IGL01583:Slc30a4	APN	2	122685217	missense	probably benign
IGL01823:Slc30a4	APN	2	122702092	missense	probably damaging	1.00
IGL02086:Slc30a4	APN	2	122702027	splice site	probably benign
F5770:Slc30a4	UTSW	2	122689538	missense	probably benign	0.00
R0060:Slc30a4	UTSW	2	122685184	missense	probably benign
R0060:Slc30a4	UTSW	2	122685184	missense	probably benign
R0373:Slc30a4	UTSW	2	122689399	missense	probably damaging	0.99
R0591:Slc30a4	UTSW	2	122685240	missense	probably damaging	1.00
R1514:Slc30a4	UTSW	2	122689414	missense	probably damaging	1.00
R1552:Slc30a4	UTSW	2	122686016	missense	probably benign	0.05
R3847:Slc30a4	UTSW	2	122702272	missense	probably damaging	1.00
R4195:Slc30a4	UTSW	2	122685270	missense	probably damaging	1.00
R4501:Slc30a4	UTSW	2	122685216	missense	probably benign
R5558:Slc30a4	UTSW	2	122686983	missense	probably damaging	1.00
R6379:Slc30a4	UTSW	2	122689549	missense	probably damaging	1.00
R6393:Slc30a4	UTSW	2	122686046	missense	probably damaging	1.00
R7394:Slc30a4	UTSW	2	122685304	missense	possibly damaging	0.93
R9464:Slc30a4	UTSW	2	122685280	missense	probably damaging	1.00
V7580:Slc30a4	UTSW	2	122689538	missense	probably benign	0.00
V7581:Slc30a4	UTSW	2	122689538	missense	probably benign	0.00
V7582:Slc30a4	UTSW	2	122689538	missense	probably benign	0.00
V7583:Slc30a4	UTSW	2	122689538	missense	probably benign	0.00

Predicted Primers

PCR Primer
(F):5'- AGTCAGGGTCATAGTTTATTATGGC -3'
(R):5'- CACAGGTGCTACATCTATGTTTC -3'

Sequencing Primer
(F):5'- TTGAGGACAGCCACAAAG -3'
(R):5'- GAGCATGCACAGATTTTGATACC -3'

Posted On

2022-11-14