Incidental Mutation 'R0784:Shc4'
Institutional Source Beutler Lab
Gene Symbol Shc4
Ensembl Gene ENSMUSG00000035109
Gene NameSHC (Src homology 2 domain containing) family, member 4
Synonyms9930029B02Rik, LOC271849, 6230417E10Rik
MMRRC Submission 038964-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.128) question?
Stock #R0784 (G1)
Quality Score225
Status Validated
Chromosomal Location125627447-125724148 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 125657496 bp
Amino Acid Change Tryptophan to Glycine at position 354 (W354G)
Ref Sequence ENSEMBL: ENSMUSP00000043146 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000042246] [ENSMUST00000110477] [ENSMUST00000110480]
Predicted Effect probably benign
Transcript: ENSMUST00000042246
AA Change: W354G

PolyPhen 2 Score 0.080 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000043146
Gene: ENSMUSG00000035109
AA Change: W354G

low complexity region 57 68 N/A INTRINSIC
PTB 187 351 1.38e-34 SMART
SH2 520 599 4.69e-24 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000110477
AA Change: W68G

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000106103
Gene: ENSMUSG00000035109
AA Change: W68G

Pfam:PID 1 62 1.7e-19 PFAM
SH2 234 313 4.69e-24 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000110480
AA Change: W68G

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000106106
Gene: ENSMUSG00000035109
AA Change: W68G

Pfam:PID 1 62 1.7e-19 PFAM
SH2 234 313 4.69e-24 SMART
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.6%
  • 3x: 98.9%
  • 10x: 96.9%
  • 20x: 92.1%
Validation Efficiency 97% (59/61)
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acin1 T C 14: 54,653,528 probably benign Het
Adamts2 C T 11: 50,668,003 R182W probably damaging Het
Ahr C T 12: 35,508,142 G293D possibly damaging Het
Akna G T 4: 63,376,888 T1028K probably benign Het
Akp3 G A 1: 87,127,871 G547R unknown Het
Asic2 T A 11: 80,893,989 M324L possibly damaging Het
Atf6 A G 1: 170,709,947 F635L probably benign Het
Atp8b2 A T 3: 89,957,073 V195E probably damaging Het
Bicd1 T A 6: 149,513,363 C525S probably damaging Het
Cbfa2t3 A G 8: 122,650,487 probably benign Het
Cd46 G A 1: 195,092,194 T11M possibly damaging Het
Cecr2 A G 6: 120,758,149 H754R possibly damaging Het
Clcn3 G T 8: 60,929,203 D450E probably benign Het
Cobl T G 11: 12,266,843 probably benign Het
Cyba T A 8: 122,427,683 T34S probably benign Het
Dennd1a A G 2: 38,021,414 L187P probably damaging Het
Dennd4c A T 4: 86,844,908 Q1817L probably benign Het
Drosha T C 15: 12,867,678 probably benign Het
Dync1li2 A G 8: 104,442,498 S34P probably damaging Het
Emilin2 T A 17: 71,275,287 D148V possibly damaging Het
Galnt11 A G 5: 25,258,909 D393G probably damaging Het
Gm5435 T A 12: 82,496,180 noncoding transcript Het
Gpr176 C T 2: 118,373,052 V46M possibly damaging Het
Gpr85 T A 6: 13,836,749 H52L probably benign Het
Grn T C 11: 102,434,502 M246T possibly damaging Het
Hnrnpul2 T C 19: 8,825,052 F428L possibly damaging Het
Hoxa13 G C 6: 52,259,937 N278K probably damaging Het
Irx5 A G 8: 92,360,490 D350G probably benign Het
Kat2a C T 11: 100,710,841 M249I probably benign Het
Klhl29 T C 12: 5,081,251 Y782C probably damaging Het
Kmt2c A T 5: 25,310,895 F2650Y probably benign Het
Lrp2 A G 2: 69,518,365 I754T probably benign Het
Mpl G A 4: 118,446,406 P472S possibly damaging Het
Mtnr1b A G 9: 15,862,785 I326T probably benign Het
Myh9 A G 15: 77,777,009 probably benign Het
Mylk G C 16: 34,879,475 E403Q possibly damaging Het
Myo9a A G 9: 59,896,545 probably benign Het
Olfr1187-ps1 T A 2: 88,540,167 noncoding transcript Het
Olfr30 T A 11: 58,455,305 I215F possibly damaging Het
Oraov1 A T 7: 144,919,277 Y108F probably benign Het
Pcsk5 T C 19: 17,714,769 M184V probably benign Het
Piezo2 T A 18: 63,083,235 D1143V probably damaging Het
Prr36 G T 8: 4,213,771 probably benign Het
Rnf220 C A 4: 117,277,998 probably benign Het
Senp3 A G 11: 69,680,448 L131P probably damaging Het
Slc6a15 A G 10: 103,416,800 probably benign Het
Smtnl2 T C 11: 72,399,937 D394G probably damaging Het
Sry G T Y: 2,662,731 Q310K unknown Het
St7l A G 3: 104,870,924 M126V probably benign Het
St8sia3 T C 18: 64,271,701 W350R probably damaging Het
Stk35 A T 2: 129,810,802 K408* probably null Het
Svs1 T A 6: 48,987,301 M81K possibly damaging Het
Thsd7b T C 1: 129,595,359 probably benign Het
Tmem106b T C 6: 13,084,253 V252A probably damaging Het
Trpm7 A G 2: 126,846,072 probably null Het
Ttf2 T C 3: 100,962,710 D349G probably benign Het
Zfp386 T A 12: 116,059,920 C419* probably null Het
Zfp541 A G 7: 16,082,992 probably benign Het
Other mutations in Shc4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02298:Shc4 APN 2 125649154 missense probably damaging 0.96
IGL03003:Shc4 APN 2 125723333 nonsense probably null
R0167:Shc4 UTSW 2 125723013 missense probably benign 0.00
R0959:Shc4 UTSW 2 125678687 critical splice donor site probably null
R1099:Shc4 UTSW 2 125722844 missense probably benign 0.03
R1864:Shc4 UTSW 2 125639367 missense probably damaging 1.00
R2198:Shc4 UTSW 2 125639346 missense possibly damaging 0.46
R3791:Shc4 UTSW 2 125723331 missense probably damaging 0.97
R4324:Shc4 UTSW 2 125678750 missense probably benign 0.23
R4424:Shc4 UTSW 2 125652522 missense probably benign
R4611:Shc4 UTSW 2 125655682 missense probably benign 0.29
R4745:Shc4 UTSW 2 125649277 missense probably damaging 0.96
R5037:Shc4 UTSW 2 125629727 missense probably damaging 1.00
R5433:Shc4 UTSW 2 125639430 missense probably damaging 1.00
R5754:Shc4 UTSW 2 125670298 missense probably damaging 1.00
R7795:Shc4 UTSW 2 125723365 missense probably damaging 0.99
R8058:Shc4 UTSW 2 125649234
Z1177:Shc4 UTSW 2 125722923
Predicted Primers PCR Primer

Sequencing Primer
(F):5'- acacagggtttcaccaagtag -3'
Posted On2013-10-16