Ensembl:   ENSMUST00000019400 

Incidental Mutation 'R0784:Ahr'
ID 76789
Institutional Source Beutler Lab
Gene Symbol Ahr
Ensembl Gene ENSMUSG00000019256
Gene Name aryl-hydrocarbon receptor
Synonyms bHLHe76, In, dioxin receptor, Ah, Ahh, Ahre
MMRRC Submission 038964-MU
Accession Numbers

Genbank: NM_013464; MGI: 105043; 

  
Essential gene? Probably essential (E-score: 0.949) question?
Stock # R0784 (G1)
Quality Score 225
Status Validated
Chromosome 12
Chromosomal Location 35497974-35535038 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) C to T at 35508142 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Glycine to Aspartic acid at position 293 (G293D)
Ref Sequence ENSEMBL: ENSMUSP00000112137 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000110811] [ENSMUST00000116436]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000110811
SMART Domains Protein: ENSMUSP00000106434
Gene: ENSMUSG00000019256

DomainStartEndE-ValueType
HLH 33 87 3.31e-6 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000116436
AA Change: G293D

PolyPhen 2 Score 0.790 (Sensitivity: 0.85; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000112137
Gene: ENSMUSG00000019256
AA Change: G293D

DomainStartEndE-ValueType
HLH 33 87 5.09e-7 SMART
PAS 111 177 2.72e-12 SMART
low complexity region 212 222 N/A INTRINSIC
PAS 266 336 1.77e-2 SMART
PAC 342 383 2.39e-8 SMART
low complexity region 606 640 N/A INTRINSIC
Meta Mutation Damage Score 0.2402 question?
Coding Region Coverage
  • 1x: 99.6%
  • 3x: 98.9%
  • 10x: 96.9%
  • 20x: 92.1%
Validation Efficiency 97% (59/61)
MGI Phenotype FUNCTION: The protein encoded by this gene is a ligand-activated helix-loop-helix transcription factor involved in the regulation of biological responses to planar aromatic hydrocarbons. This receptor has been shown to regulate xenobiotic-metabolizing enzymes such as cytochrome P450. Before ligand binding, the encoded protein is sequestered in the cytoplasm; upon ligand binding, this protein moves to the nucleus and stimulates transcription of target genes. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Sep 2015]
PHENOTYPE: Homozygotes for null or hypomorphic alleles do not respond to cyclic compounds (e.g., dioxin) and are resistant to their teratogenic effects. Depending on the allele, null mutants may also have liver defects, impaired female fertility, neonatal or postnatal lethality, and spleen abnormalities. [provided by MGI curators]
Allele List at MGI

All alleles(12) : Targeted, knock-out(2) Targeted, other(6) Other(4)
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acin1 T C 14: 54,653,528 probably benign Het
Adamts2 C T 11: 50,668,003 R182W probably damaging Het
Akna G T 4: 63,376,888 T1028K probably benign Het
Akp3 G A 1: 87,127,871 G547R unknown Het
Asic2 T A 11: 80,893,989 M324L possibly damaging Het
Atf6 A G 1: 170,709,947 F635L probably benign Het
Atp8b2 A T 3: 89,957,073 V195E probably damaging Het
Bicd1 T A 6: 149,513,363 C525S probably damaging Het
Cbfa2t3 A G 8: 122,650,487 probably benign Het
Cd46 G A 1: 195,092,194 T11M possibly damaging Het
Cecr2 A G 6: 120,758,149 H754R possibly damaging Het
Clcn3 G T 8: 60,929,203 D450E probably benign Het
Cobl T G 11: 12,266,843 probably benign Het
Cyba T A 8: 122,427,683 T34S probably benign Het
Dennd1a A G 2: 38,021,414 L187P probably damaging Het
Dennd4c A T 4: 86,844,908 Q1817L probably benign Het
Drosha T C 15: 12,867,678 probably benign Het
Dync1li2 A G 8: 104,442,498 S34P probably damaging Het
Emilin2 T A 17: 71,275,287 D148V possibly damaging Het
Galnt11 A G 5: 25,258,909 D393G probably damaging Het
Gm5435 T A 12: 82,496,180 noncoding transcript Het
Gpr176 C T 2: 118,373,052 V46M possibly damaging Het
Gpr85 T A 6: 13,836,749 H52L probably benign Het
Grn T C 11: 102,434,502 M246T possibly damaging Het
Hnrnpul2 T C 19: 8,825,052 F428L possibly damaging Het
Hoxa13 G C 6: 52,259,937 N278K probably damaging Het
Irx5 A G 8: 92,360,490 D350G probably benign Het
Kat2a C T 11: 100,710,841 M249I probably benign Het
Klhl29 T C 12: 5,081,251 Y782C probably damaging Het
Kmt2c A T 5: 25,310,895 F2650Y probably benign Het
Lrp2 A G 2: 69,518,365 I754T probably benign Het
Mpl G A 4: 118,446,406 P472S possibly damaging Het
Mtnr1b A G 9: 15,862,785 I326T probably benign Het
Myh9 A G 15: 77,777,009 probably benign Het
Mylk G C 16: 34,879,475 E403Q possibly damaging Het
Myo9a A G 9: 59,896,545 probably benign Het
Olfr1187-ps1 T A 2: 88,540,167 noncoding transcript Het
Olfr30 T A 11: 58,455,305 I215F possibly damaging Het
Oraov1 A T 7: 144,919,277 Y108F probably benign Het
Pcsk5 T C 19: 17,714,769 M184V probably benign Het
Piezo2 T A 18: 63,083,235 D1143V probably damaging Het
Prr36 G T 8: 4,213,771 probably benign Het
Rnf220 C A 4: 117,277,998 probably benign Het
Senp3 A G 11: 69,680,448 L131P probably damaging Het
Shc4 A C 2: 125,657,496 W354G probably benign Het
Slc6a15 A G 10: 103,416,800 probably benign Het
Smtnl2 T C 11: 72,399,937 D394G probably damaging Het
Sry G T Y: 2,662,731 Q310K unknown Het
St7l A G 3: 104,870,924 M126V probably benign Het
St8sia3 T C 18: 64,271,701 W350R probably damaging Het
Stk35 A T 2: 129,810,802 K408* probably null Het
Svs1 T A 6: 48,987,301 M81K possibly damaging Het
Thsd7b T C 1: 129,595,359 probably benign Het
Tmem106b T C 6: 13,084,253 V252A probably damaging Het
Trpm7 A G 2: 126,846,072 probably null Het
Ttf2 T C 3: 100,962,710 D349G probably benign Het
Zfp386 T A 12: 116,059,920 C419* probably null Het
Zfp541 A G 7: 16,082,992 probably benign Het
Other mutations in Ahr
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00589:Ahr APN 12 35504097 nonsense probably null
IGL01336:Ahr APN 12 35503840 missense probably benign 0.19
IGL01972:Ahr APN 12 35504449 missense possibly damaging 0.89
IGL02117:Ahr APN 12 35512923 nonsense probably null
IGL03028:Ahr APN 12 35504710 missense probably benign
IGL03110:Ahr APN 12 35504971 missense probably damaging 0.98
IGL03394:Ahr APN 12 35503752 nonsense probably null
IGL03403:Ahr APN 12 35504326 missense possibly damaging 0.63
BB002:Ahr UTSW 12 35515068 nonsense probably null
BB012:Ahr UTSW 12 35515068 nonsense probably null
R0620:Ahr UTSW 12 35508194 missense probably benign 0.26
R1133:Ahr UTSW 12 35526806 missense probably damaging 1.00
R1168:Ahr UTSW 12 35504532 missense possibly damaging 0.49
R4678:Ahr UTSW 12 35507464 missense probably damaging 1.00
R5615:Ahr UTSW 12 35503885 missense probably benign 0.01
R6066:Ahr UTSW 12 35504921 missense probably damaging 0.99
R6466:Ahr UTSW 12 35504032 missense probably benign 0.29
R7369:Ahr UTSW 12 35504660 missense possibly damaging 0.94
R7382:Ahr UTSW 12 35504515 missense probably damaging 1.00
R7685:Ahr UTSW 12 35504017 missense probably damaging 0.96
R7819:Ahr UTSW 12 35510000 missense probably damaging 1.00
R7897:Ahr UTSW 12 35504170 missense possibly damaging 0.47
R7925:Ahr UTSW 12 35515068 nonsense probably null
R8179:Ahr UTSW 12 35510051 missense probably benign 0.01
R8274:Ahr UTSW 12 35510069 missense probably benign
R8342:Ahr UTSW 12 35508272 missense probably damaging 1.00
R8985:Ahr UTSW 12 35526737 missense possibly damaging 0.91
R9069:Ahr UTSW 12 35512772 intron probably benign
R9114:Ahr UTSW 12 35511165 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GTGGTATGCGATTTCCACAACATTCAAA -3'
(R):5'- AGGCAATGAATTTCCAAGGGAGGTTAAA -3'

Sequencing Primer
(F):5'- AGAGACAGGGTCTGTCATTTATTC -3'
(R):5'- GAATTTCCAAGGGAGGTTAAAGTATC -3'
Posted On 2013-10-16