Mutagenetix > Incidental Mutation

Incidental Mutation 'R0863:Ctnnbl1'

82178

Institutional Source

Beutler Lab

Gene Symbol

Ctnnbl1

Ensembl Gene

ENSMUSG00000027649

Gene Name

catenin, beta like 1

Synonyms

P14L, FLJ21108, NYD-SP19, 5730471K09Rik

MMRRC Submission

039037-MU

Accession Numbers

Essential gene?

Probably essential (E-score: 0.963) question?

Stock #

R0863 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

157737401-157891614 bp(+) (GRCm38)

Type of Mutation

splice site

DNA Base Change (assembly)

C to T at 157799417 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000029178 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000029178]

AlphaFold

Q9CWL8

Predicted Effect

probably benign
Transcript: ENSMUST00000029178

SMART Domains

Protein: ENSMUSP00000029178
Gene: ENSMUSG00000027649

Domain	Start	End	E-Value	Type
DUF1716	52	162	3.97e-61	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000129842

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000155479

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000156300

Meta Mutation Damage Score

0.0898

Coding Region Coverage

1x: 99.5%
3x: 98.9%
10x: 97.4%
20x: 94.8%

Validation Efficiency

94% (59/63)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a component of the pre-mRNA-processing factor 19-cell division cycle 5-like (PRP19-CDC5L) protein complex, which activates pre-mRNA splicing and is an integral part of the spliceosome. The encoded protein is also a nuclear localization sequence binding protein, and binds to activation-induced deaminase and is important for antibody diversification. This gene may also be associated with the development of obesity. Alternative splicing results in multiple transcript variants. A pseudogene of this gene has been defined on the X chromosome. [provided by RefSeq, Jul 2013]
PHENOTYPE:

Allele List at MGI

Other mutations in this stock

Total: 59 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700057G04Rik	A	T	9: 92,351,087	I88L	possibly damaging	Het
2310016G11Rik	A	G	7: 44,677,808		noncoding transcript	Het
4930433I11Rik	A	T	7: 40,993,056	T141S	probably benign	Het
Abca14	A	T	7: 120,216,230	T234S	probably benign	Het
Acap1	C	A	11: 69,887,056	V119L	probably damaging	Het
Actr2	C	T	11: 20,080,760	V163I	probably benign	Het
Adcy4	T	C	14: 55,783,599	Y27C	probably damaging	Het
Arnt2	T	A	7: 84,265,584	K524M	probably damaging	Het
Brca1	T	C	11: 101,524,770	Y846C	probably benign	Het
Capn7	T	A	14: 31,369,757	C704S	possibly damaging	Het
Cep350	T	A	1: 155,862,235	I2621L	probably benign	Het
Col11a1	G	A	3: 114,138,765	R113H	unknown	Het
Cul9	T	C	17: 46,537,822		probably null	Het
Erc2	A	C	14: 28,025,148	N345T	probably benign	Het
Fank1	A	G	7: 133,880,623	R73G	possibly damaging	Het
Fes	A	T	7: 80,380,886	W552R	probably damaging	Het
Fsd2	A	G	7: 81,542,165	V488A	possibly damaging	Het
Gfm1	T	C	3: 67,474,595	S705P	probably damaging	Het
Gm9493	A	T	19: 23,619,809	Q23L	probably benign	Het
Gucy1b2	T	C	14: 62,419,062	D282G	probably benign	Het
H2-Ab1	T	C	17: 34,267,354	I129T	probably damaging	Het
H2-M10.3	T	A	17: 36,366,690	Y232F	probably damaging	Het
Iqca	C	A	1: 90,142,731	G133V	probably null	Het
Lonp1	T	C	17: 56,618,331	K487R	probably damaging	Het
Ltbp1	A	G	17: 75,252,386	Y290C	probably damaging	Het
Mgea5	C	T	19: 45,782,986	A49T	probably benign	Het
Ms4a10	C	T	19: 10,968,593	G58D	probably damaging	Het
Muc5b	A	G	7: 141,867,717	S4315G	probably benign	Het
Nlrp1b	T	A	11: 71,181,347	T557S	probably benign	Het
Nlrp3	A	G	11: 59,565,850	D946G	probably benign	Het
Obscn	T	C	11: 58,995,415		probably benign	Het
Olfr469	T	C	7: 107,823,374	S32G	probably benign	Het
Olfr509	A	G	7: 108,645,658	I306T	probably benign	Het
Olfr866	A	T	9: 20,027,213	S242T	probably damaging	Het
Pask	A	T	1: 93,314,339	F1219I	probably damaging	Het
Pcdhb2	G	A	18: 37,295,657	V228I	possibly damaging	Het
Phf1	T	C	17: 26,937,140		probably benign	Het
Plec	G	A	15: 76,174,080	Q3751*	probably null	Het
Ppp1r12c	G	T	7: 4,486,366	Q240K	probably damaging	Het
Ralgapa1	A	T	12: 55,762,681	Y436*	probably null	Het
Ralgapa1	C	A	12: 55,782,777		probably benign	Het
Scel	T	A	14: 103,586,480	S381R	possibly damaging	Het
Sema4a	C	T	3: 88,448,149		probably benign	Het
Sltm	A	G	9: 70,561,908	T150A	probably benign	Het
Spag1	G	T	15: 36,192,047	K217N	probably damaging	Het
Ssh1	C	T	5: 113,966,731	R9H	probably damaging	Het
St3gal4	C	A	9: 35,053,448	V155F	probably damaging	Het
Stxbp5	C	T	10: 9,809,040	E539K	possibly damaging	Het
Tbc1d7	G	T	13: 43,154,685		probably benign	Het
Thnsl2	A	T	6: 71,134,224	L220*	probably null	Het
Tinf2	G	A	14: 55,680,109	P308S	probably benign	Het
Tnf	T	C	17: 35,201,144		probably benign	Het
Ttc21b	T	C	2: 66,242,773	I190V	probably benign	Het
Ttn	T	C	2: 76,707,047	T34846A	probably benign	Het
Ube4a	A	G	9: 44,949,816	V232A	possibly damaging	Het
Uri1	A	T	7: 37,969,675	D122E	probably damaging	Het
Vmn2r94	T	G	17: 18,257,711	Q146P	probably damaging	Het
Zan	T	A	5: 137,458,639	E1278D	unknown	Het
Zfhx4	T	A	3: 5,245,315	S919R	possibly damaging	Het

Other mutations in Ctnnbl1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00754:Ctnnbl1	APN	2	157819541	missense	possibly damaging	0.80
IGL01374:Ctnnbl1	APN	2	157836693	critical splice donor site	probably null
IGL01504:Ctnnbl1	APN	2	157818116	splice site	probably benign
IGL01622:Ctnnbl1	APN	2	157819548	missense	probably damaging	1.00
IGL01623:Ctnnbl1	APN	2	157819548	missense	probably damaging	1.00
IGL02146:Ctnnbl1	APN	2	157819494	missense	probably damaging	1.00
IGL02550:Ctnnbl1	APN	2	157884135	missense	probably benign	0.00
IGL03104:Ctnnbl1	APN	2	157890965	missense	probably damaging	0.99
IGL03164:Ctnnbl1	APN	2	157817761	missense	probably benign
R0482:Ctnnbl1	UTSW	2	157871190	critical splice donor site	probably null
R0826:Ctnnbl1	UTSW	2	157799417	splice site	probably benign
R0827:Ctnnbl1	UTSW	2	157799417	splice site	probably benign
R0862:Ctnnbl1	UTSW	2	157799417	splice site	probably benign
R0864:Ctnnbl1	UTSW	2	157799417	splice site	probably benign
R1466:Ctnnbl1	UTSW	2	157799417	splice site	probably benign
R1533:Ctnnbl1	UTSW	2	157836643	missense	probably benign
R2971:Ctnnbl1	UTSW	2	157871186	missense	probably benign	0.06
R3522:Ctnnbl1	UTSW	2	157871193	splice site	probably null
R4296:Ctnnbl1	UTSW	2	157819570	splice site	probably null
R4982:Ctnnbl1	UTSW	2	157836553	missense	probably benign	0.01
R5396:Ctnnbl1	UTSW	2	157817832	splice site	probably null
R5857:Ctnnbl1	UTSW	2	157789098	missense	probably damaging	1.00
R7710:Ctnnbl1	UTSW	2	157774571	missense	probably benign	0.00
R7769:Ctnnbl1	UTSW	2	157737470	start gained	probably benign
R8134:Ctnnbl1	UTSW	2	157809471	missense	probably benign	0.19
R8324:Ctnnbl1	UTSW	2	157779815	missense	probably damaging	0.97
R8384:Ctnnbl1	UTSW	2	157818060	missense	probably benign	0.01
R8430:Ctnnbl1	UTSW	2	157836683	missense	probably damaging	0.99
R9116:Ctnnbl1	UTSW	2	157806703	missense	probably damaging	1.00
R9244:Ctnnbl1	UTSW	2	157836663	missense	possibly damaging	0.63
R9350:Ctnnbl1	UTSW	2	157809525	missense	possibly damaging	0.91

Predicted Primers

PCR Primer
(F):5'- AAGAGCTAGAAATGCAGCGTCCCC -3'
(R):5'- CCAAGAGCACTTGGTTAGTAGGCAC -3'

Sequencing Primer
(F):5'- GCGTCCCCAGATTTAAAGCTTG -3'
(R):5'- AGCATTCTACGGATGCCC -3'

Posted On

2013-11-08