Incidental Mutation 'R0920:Krt76'
ID 82833
Institutional Source Beutler Lab
Gene Symbol Krt76
Ensembl Gene ENSMUSG00000075402
Gene Name keratin 76
Synonyms 2310001L23Rik
MMRRC Submission 039070-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R0920 (G1)
Quality Score 225
Status Validated
Chromosome 15
Chromosomal Location 101884351-101892920 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 101892439 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Threonine to Alanine at position 141 (T141A)
Ref Sequence ENSEMBL: ENSMUSP00000097754 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000100179]
AlphaFold Q3UV17
Predicted Effect possibly damaging
Transcript: ENSMUST00000100179
AA Change: T141A

PolyPhen 2 Score 0.804 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000097754
Gene: ENSMUSG00000075402
AA Change: T141A

DomainStartEndE-ValueType
Pfam:Keratin_2_head 16 161 5.7e-39 PFAM
Filament 164 479 2.12e-166 SMART
low complexity region 488 551 N/A INTRINSIC
low complexity region 565 593 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000196731
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.9%
  • 10x: 97.6%
  • 20x: 95.9%
Validation Efficiency 100% (37/37)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Keratins are intermediate filament proteins responsible for the structural integrity of epithelial cells and are subdivided into epithelial keratins and hair keratins. The type II keratins are clustered in a region of chromosome 12q13. [provided by RefSeq, Jun 2009]
PHENOTYPE: Homozygotes mutants exhibit abnormalities in the hair cycle, tail skin and pigmentation, in the epidermis, and in the sebaceous gland. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110004E09Rik C T 16: 90,927,379 E125K probably damaging Het
Adamts16 A G 13: 70,763,561 probably benign Het
Adgra3 A G 5: 49,961,161 V1015A probably benign Het
Armc5 G T 7: 128,240,319 A270S probably damaging Het
Cacng1 A C 11: 107,705,856 probably benign Het
Ccdc33 T C 9: 58,033,672 D429G probably damaging Het
Ccdc88b G T 19: 6,846,649 A1412E probably benign Het
Clock A T 5: 76,230,320 S578T possibly damaging Het
Crp T C 1: 172,698,522 F58S probably damaging Het
Dlg5 T A 14: 24,176,397 Q125L probably damaging Het
Eif3i T C 4: 129,595,257 probably benign Het
Gm13124 T C 4: 144,561,126 probably benign Het
Gucy1a2 A C 9: 3,759,472 D426A probably damaging Het
Hpcal1 C T 12: 17,791,097 probably benign Het
Inf2 T A 12: 112,610,287 probably benign Het
Kdm7a A G 6: 39,151,322 L525P probably damaging Het
Kirrel3 A T 9: 35,028,352 I152F probably damaging Het
Knl1 T A 2: 119,069,828 I670K probably benign Het
Ldb3 T C 14: 34,567,503 T249A probably benign Het
Magi3 A T 3: 104,034,191 probably null Het
Mfn1 A G 3: 32,534,236 probably null Het
Myb G T 10: 21,126,234 T736K possibly damaging Het
Myo5b A C 18: 74,625,641 K231T probably benign Het
Myt1l T A 12: 29,886,139 C909S unknown Het
Npas4 C A 19: 4,986,316 E607* probably null Het
Nphp3 A G 9: 104,031,907 N772S probably benign Het
Nup88 G T 11: 70,956,320 P288Q possibly damaging Het
Olfr166 A T 16: 19,486,930 I31F probably benign Het
Pknox1 C A 17: 31,596,891 Q240K probably damaging Het
Plce1 A C 19: 38,736,521 T1439P probably damaging Het
Ppp1r42 T A 1: 9,999,525 N104I probably damaging Het
Prkar2a T A 9: 108,719,297 probably benign Het
Stox2 C T 8: 47,193,018 R469Q probably damaging Het
Syna A G 5: 134,559,102 V331A probably benign Het
Vmn1r58 A T 7: 5,410,789 N147K probably benign Het
Zdhhc6 A T 19: 55,311,701 L148H probably damaging Het
Other mutations in Krt76
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01325:Krt76 APN 15 101884888 missense unknown
IGL01475:Krt76 APN 15 101888513 missense probably benign 0.11
IGL01504:Krt76 APN 15 101888173 missense probably damaging 1.00
IGL01506:Krt76 APN 15 101892400 missense probably damaging 0.97
IGL01943:Krt76 APN 15 101889045 missense probably null 0.98
IGL03164:Krt76 APN 15 101887451 missense possibly damaging 0.50
PIT4378001:Krt76 UTSW 15 101892407 missense probably damaging 0.99
R0105:Krt76 UTSW 15 101884912 missense unknown
R0105:Krt76 UTSW 15 101884912 missense unknown
R0448:Krt76 UTSW 15 101890647 missense probably damaging 1.00
R0730:Krt76 UTSW 15 101887349 missense probably damaging 1.00
R1568:Krt76 UTSW 15 101885008 missense unknown
R1779:Krt76 UTSW 15 101892687 missense unknown
R1869:Krt76 UTSW 15 101889487 critical splice donor site probably null
R1911:Krt76 UTSW 15 101888165 nonsense probably null
R2160:Krt76 UTSW 15 101888385 missense probably damaging 1.00
R2504:Krt76 UTSW 15 101884858 missense unknown
R4487:Krt76 UTSW 15 101890482 missense possibly damaging 0.71
R4729:Krt76 UTSW 15 101889081 missense probably damaging 1.00
R4747:Krt76 UTSW 15 101885745 missense probably damaging 1.00
R4912:Krt76 UTSW 15 101888162 nonsense probably null
R5357:Krt76 UTSW 15 101887385 missense probably benign 0.04
R6738:Krt76 UTSW 15 101887478 missense probably benign 0.40
R7786:Krt76 UTSW 15 101890530 missense probably damaging 0.98
R7808:Krt76 UTSW 15 101890494 missense probably damaging 1.00
R7825:Krt76 UTSW 15 101887503 missense possibly damaging 0.46
R8079:Krt76 UTSW 15 101888390 missense possibly damaging 0.61
R8846:Krt76 UTSW 15 101887337 missense probably damaging 1.00
R8980:Krt76 UTSW 15 101892555 missense unknown
Z1088:Krt76 UTSW 15 101890551 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGCCATCCCAAGATGTGTGCAAG -3'
(R):5'- AAGAGTATTTCTATCAGCGTGGCGG -3'

Sequencing Primer
(F):5'- AGGTGTTCTCAGTATCCTGGAAAC -3'
(R):5'- CTTCAGTGGAGGGCGTAGC -3'
Posted On 2013-11-08