Mutagenetix > Incidental Mutation

Incidental Mutation 'R1911:Krt76'

210307

Institutional Source

Beutler Lab

Gene Symbol

Krt76

Ensembl Gene

ENSMUSG00000075402

Gene Name

keratin 76

Synonyms

2310001L23Rik

MMRRC Submission

039929-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R1911 (G1)

Quality Score

181

Status

Validated

Chromosome

Chromosomal Location

101884351-101892920 bp(-) (GRCm38)

Type of Mutation

nonsense

DNA Base Change (assembly)

T to A at 101888165 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Lysine to Stop codon at position 403 (K403*)

Ref Sequence

ENSEMBL: ENSMUSP00000097754 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000100179]

AlphaFold

Q3UV17

Predicted Effect

probably null
Transcript: ENSMUST00000100179
AA Change: K403*

SMART Domains

Protein: ENSMUSP00000097754
Gene: ENSMUSG00000075402
AA Change: K403*

Domain	Start	End	E-Value	Type
Pfam:Keratin_2_head	16	161	5.7e-39	PFAM
Filament	164	479	2.12e-166	SMART
low complexity region	488	551	N/A	INTRINSIC
low complexity region	565	593	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000196731

Meta Mutation Damage Score

0.9755

Coding Region Coverage

1x: 97.3%
3x: 96.8%
10x: 95.4%
20x: 93.2%

Validation Efficiency

99% (99/100)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Keratins are intermediate filament proteins responsible for the structural integrity of epithelial cells and are subdivided into epithelial keratins and hair keratins. The type II keratins are clustered in a region of chromosome 12q13. [provided by RefSeq, Jun 2009]
PHENOTYPE: Homozygotes mutants exhibit abnormalities in the hair cycle, tail skin and pigmentation, in the epidermis, and in the sebaceous gland. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 96 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700015F17Rik	C	A	5: 5,452,019	W144C	probably benign	Het
4930590J08Rik	T	A	6: 91,950,069		probably benign	Het
5430419D17Rik	T	C	7: 131,238,089	V580A	probably damaging	Het
Abca7	T	C	10: 80,006,634	V1134A	probably benign	Het
Acaa2	A	G	18: 74,792,412	E82G	probably benign	Het
Acap1	T	C	11: 69,881,722	D521G	probably damaging	Het
Adam19	T	C	11: 46,121,454	V259A	probably damaging	Het
Adssl1	T	C	12: 112,633,009	V140A	probably benign	Het
Aif1	G	A	17: 35,172,151	P44L	probably benign	Het
Aldh3b1	T	G	19: 3,921,187	D159A	probably damaging	Het
Ank1	T	C	8: 23,099,650	V589A	probably damaging	Het
Ano2	G	A	6: 126,013,691	D803N	probably benign	Het
Arid1b	A	G	17: 5,342,966	E2257G	probably damaging	Het
Asb17	T	C	3: 153,844,501	Y57H	probably benign	Het
Asph	T	C	4: 9,453,335	E646G	probably damaging	Het
Aspm	T	A	1: 139,478,094	I1573K	probably benign	Het
Bcas1	C	A	2: 170,387,943	D236Y	probably damaging	Het
Bcas2	G	T	3: 103,171,797	G9*	probably null	Het
Btaf1	A	G	19: 36,986,630	Q867R	probably benign	Het
C87499	T	C	4: 88,630,072	Q32R	possibly damaging	Het
Calhm3	C	T	19: 47,155,469	V132I	possibly damaging	Het
Ccer1	A	T	10: 97,694,677	I401F	possibly damaging	Het
Cecr2	T	A	6: 120,762,565		probably benign	Het
Cep104	G	A	4: 154,006,798	R925Q	possibly damaging	Het
Cep164	T	A	9: 45,770,806	M1900L	probably benign	Het
Crybg1	A	G	10: 43,997,677	V1145A	possibly damaging	Het
Cyp2a4	T	A	7: 26,308,974	N180K	possibly damaging	Het
Dennd4a	T	C	9: 64,889,086	L798P	probably damaging	Het
Dmxl1	T	C	18: 49,878,163	I1129T	probably benign	Het
Dnah2	T	C	11: 69,515,752	N555D	possibly damaging	Het
Dock1	T	A	7: 134,999,300	M988K	probably damaging	Het
Elp4	T	A	2: 105,702,743	H419L	probably damaging	Het
Endov	T	C	11: 119,502,351	V109A	possibly damaging	Het
Epha8	T	C	4: 136,936,314	Y477C	probably damaging	Het
Erlin1	A	G	19: 44,049,122	M188T	probably damaging	Het
Fam160a1	T	A	3: 85,661,218	D998V	probably benign	Het
Fhod3	A	T	18: 25,112,586	D1231V	possibly damaging	Het
Gimap3	T	A	6: 48,765,712	I95F	possibly damaging	Het
Gm10717	T	G	9: 3,026,317	F205C	probably damaging	Het
Grk1	C	A	8: 13,407,923	D274E	probably damaging	Het
Gsdmc2	G	A	15: 63,827,772	A269V	probably benign	Het
Krt33a	T	A	11: 100,012,349	Q289L	probably benign	Het
Lcn4	T	C	2: 26,670,595		probably benign	Het
Mab21l1	T	C	3: 55,783,627	S212P	possibly damaging	Het
Mapk8ip3	A	C	17: 24,904,051	D610E	probably benign	Het
Mastl	G	T	2: 23,132,680	S677*	probably null	Het
Mfap3	T	C	11: 57,529,736	F181S	probably damaging	Het
Mlkl	T	C	8: 111,312,100		probably benign	Het
Mov10	G	A	3: 104,801,560		probably benign	Het
Muc5ac	T	C	7: 141,796,304	F595L	probably benign	Het
Nbas	T	A	12: 13,566,144	C2228S	probably benign	Het
Nit2	G	A	16: 57,161,683		probably benign	Het
Nod1	C	T	6: 54,944,440	V298M	probably damaging	Het
Olfr1216	A	G	2: 89,013,221	L281P	probably damaging	Het
Olfr399	C	A	11: 74,054,384	R125L	probably damaging	Het
Olfr690	T	A	7: 105,329,383	I270F	probably benign	Het
Olfr800	A	T	10: 129,660,112	D102V	probably benign	Het
Olfr834	T	C	9: 18,988,900	L304P	probably damaging	Het
Osbpl5	C	A	7: 143,689,925	R864L	probably benign	Het
Pcnt	G	A	10: 76,368,816	T2585M	possibly damaging	Het
Pepd	C	T	7: 34,934,749		probably benign	Het
Pou6f2	T	C	13: 18,151,963	I341V	probably damaging	Het
Prune2	T	A	19: 17,113,674	F281I	probably benign	Het
Psg19	T	G	7: 18,794,268	Q183H	probably damaging	Het
Psme4	T	G	11: 30,815,658	S587A	probably benign	Het
Ptpro	T	C	6: 137,400,619		probably benign	Het
Rasgrp4	T	C	7: 29,138,877	V92A	probably damaging	Het
Rem1	G	A	2: 152,634,535	V238M	probably damaging	Het
Rexo5	C	T	7: 119,799,644	A68V	probably damaging	Het
Robo2	A	T	16: 73,958,325	N769K	probably damaging	Het
Sfrp5	C	T	19: 42,198,798	V278I	probably benign	Het
Sidt1	A	G	16: 44,281,871	S309P	possibly damaging	Het
Slc22a6	A	C	19: 8,621,882	Q292H	probably benign	Het
Slc4a3	G	A	1: 75,553,723	R690H	probably damaging	Het
Snx7	A	T	3: 117,829,668		probably null	Het
Spag6	T	A	2: 18,715,805	Y129*	probably null	Het
Srcap	T	C	7: 127,534,822	I905T	probably damaging	Het
St6gal1	T	G	16: 23,321,633	S185A	probably damaging	Het
Sult6b1	G	A	17: 78,888,964	H250Y	possibly damaging	Het
Tdrd6	T	G	17: 43,627,088	N1023T	probably benign	Het
Tecta	C	T	9: 42,337,936	E1877K	probably damaging	Het
Tex10	C	T	4: 48,456,800	R637Q	probably benign	Het
Tex14	T	A	11: 87,495,035	D240E	probably damaging	Het
Tex47	T	C	5: 7,305,022	Y68H	probably damaging	Het
Thbs2	A	G	17: 14,689,842	V165A	probably benign	Het
Tmem126b	T	A	7: 90,469,159	Y171F	possibly damaging	Het
Tpsg1	G	T	17: 25,373,400	M46I	probably benign	Het
Trmt2a	A	G	16: 18,251,206	K304R	probably benign	Het
Ttc28	G	T	5: 111,280,750	R1845L	possibly damaging	Het
Umodl1	A	T	17: 30,992,154	T884S	possibly damaging	Het
Vmn2r77	A	G	7: 86,811,793	K776E	probably damaging	Het
Vmn2r88	T	C	14: 51,418,214	S627P	probably damaging	Het
Vrk1	T	C	12: 106,057,977		probably null	Het
Zfp644	A	G	5: 106,635,271	M1079T	possibly damaging	Het
Znrf1	T	C	8: 111,621,601	*41Q	probably null	Het
Znrf1	T	C	8: 111,621,612	F183L	possibly damaging	Het

Other mutations in Krt76

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01325:Krt76	APN	15	101884888	missense	unknown
IGL01475:Krt76	APN	15	101888513	missense	probably benign	0.11
IGL01504:Krt76	APN	15	101888173	missense	probably damaging	1.00
IGL01506:Krt76	APN	15	101892400	missense	probably damaging	0.97
IGL01943:Krt76	APN	15	101889045	missense	probably null	0.98
IGL03164:Krt76	APN	15	101887451	missense	possibly damaging	0.50
PIT4378001:Krt76	UTSW	15	101892407	missense	probably damaging	0.99
R0105:Krt76	UTSW	15	101884912	missense	unknown
R0105:Krt76	UTSW	15	101884912	missense	unknown
R0448:Krt76	UTSW	15	101890647	missense	probably damaging	1.00
R0730:Krt76	UTSW	15	101887349	missense	probably damaging	1.00
R0920:Krt76	UTSW	15	101892439	missense	possibly damaging	0.80
R1568:Krt76	UTSW	15	101885008	missense	unknown
R1779:Krt76	UTSW	15	101892687	missense	unknown
R1869:Krt76	UTSW	15	101889487	critical splice donor site	probably null
R2160:Krt76	UTSW	15	101888385	missense	probably damaging	1.00
R2504:Krt76	UTSW	15	101884858	missense	unknown
R4487:Krt76	UTSW	15	101890482	missense	possibly damaging	0.71
R4729:Krt76	UTSW	15	101889081	missense	probably damaging	1.00
R4747:Krt76	UTSW	15	101885745	missense	probably damaging	1.00
R4912:Krt76	UTSW	15	101888162	nonsense	probably null
R5357:Krt76	UTSW	15	101887385	missense	probably benign	0.04
R6738:Krt76	UTSW	15	101887478	missense	probably benign	0.40
R7786:Krt76	UTSW	15	101890530	missense	probably damaging	0.98
R7808:Krt76	UTSW	15	101890494	missense	probably damaging	1.00
R7825:Krt76	UTSW	15	101887503	missense	possibly damaging	0.46
R8079:Krt76	UTSW	15	101888390	missense	possibly damaging	0.61
R8846:Krt76	UTSW	15	101887337	missense	probably damaging	1.00
R8980:Krt76	UTSW	15	101892555	missense	unknown
Z1088:Krt76	UTSW	15	101890551	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TTAAGGTCAACCCTGCAGTTG -3'
(R):5'- GATTGCCCACACTTTACAAGGC -3'

Sequencing Primer
(F):5'- GTCAACCCTGCAGTTGTCAGATTAG -3'
(R):5'- ACACTTTACAAGGCTGTGCTG -3'

Posted On

2014-06-30