Incidental Mutation 'R1245:Kctd7'
ID152122
Institutional Source Beutler Lab
Gene Symbol Kctd7
Ensembl Gene ENSMUSG00000034110
Gene Namepotassium channel tetramerisation domain containing 7
Synonyms
MMRRC Submission 039312-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.097) question?
Stock #R1245 (G1)
Quality Score225
Status Validated
Chromosome5
Chromosomal Location130144861-130155806 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 130148217 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Arginine at position 96 (H96R)
Ref Sequence ENSEMBL: ENSMUSP00000121490 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000040616] [ENSMUST00000144467] [ENSMUST00000144878]
Predicted Effect probably benign
Transcript: ENSMUST00000040616
AA Change: H103R

PolyPhen 2 Score 0.309 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000044568
Gene: ENSMUSG00000034110
AA Change: H103R

DomainStartEndE-ValueType
BTB 51 149 1.59e-9 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000144467
AA Change: H96R

PolyPhen 2 Score 0.928 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000121490
Gene: ENSMUSG00000034110
AA Change: H96R

DomainStartEndE-ValueType
BTB 44 142 1.59e-9 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000144878
Meta Mutation Damage Score 0.066 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.2%
  • 10x: 95.9%
  • 20x: 91.5%
Validation Efficiency 98% (41/42)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the potassium channel tetramerization domain-containing protein family. Family members are identified on a structural basis and contain an amino-terminal domain similar to the T1 domain present in the voltage-gated potassium channel. Mutations in this gene have been associated with progressive myoclonic epilepsy-3. Alternative splicing results in multiple transcript variants.[provided by RefSeq, Jan 2011]
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adcy1 T A 11: 7,169,410 probably benign Het
Ahnak A G 19: 9,004,169 N939S probably benign Het
Cblb C A 16: 52,047,187 probably benign Het
Cd22 A G 7: 30,869,883 S603P probably damaging Het
Col6a6 G A 9: 105,748,910 R1515C possibly damaging Het
Csf1r C A 18: 61,114,812 D317E probably benign Het
Dlg2 T C 7: 92,442,595 probably benign Het
Enpp3 G A 10: 24,784,953 probably benign Het
G530012D18Rik CAGAGAGA CAGAGAGAGA 1: 85,577,224 probably null Het
Gm5828 A T 1: 16,769,129 noncoding transcript Het
Gpr137c T C 14: 45,279,065 probably benign Het
Ibtk A G 9: 85,720,742 probably null Het
Lmcd1 T A 6: 112,315,712 V175E probably benign Het
Lrfn2 A T 17: 49,096,249 probably null Het
Ltbp1 C T 17: 75,327,194 probably benign Het
Myc A G 15: 61,987,897 I140V probably damaging Het
Nckap1l A G 15: 103,455,925 E100G probably damaging Het
Ncs1 A G 2: 31,284,693 N143S probably benign Het
Nmnat2 A G 1: 153,112,203 D238G probably benign Het
Olfr1122 T A 2: 87,388,209 V168E probably benign Het
Ppp2r3a G A 9: 101,194,394 T675I probably damaging Het
Psma2 A G 13: 14,613,291 Y6C probably damaging Het
Rspo4 G A 2: 151,867,926 E84K probably damaging Het
Shank2 G A 7: 144,411,720 V1015I probably benign Het
Slc35e1 T C 8: 72,492,571 probably benign Het
Smg8 T C 11: 87,083,610 D632G possibly damaging Het
Sppl2a A T 2: 126,913,521 probably benign Het
Svep1 A G 4: 58,066,427 probably null Het
Ttn T A 2: 76,945,700 K1666M probably damaging Het
Ulk1 A G 5: 110,789,340 probably null Het
Unc80 A G 1: 66,555,095 D1211G possibly damaging Het
Vmn2r112 A G 17: 22,603,247 Q302R probably benign Het
Vmn2r6 A G 3: 64,556,790 S208P possibly damaging Het
Wnk1 C T 6: 119,948,457 V1847I probably benign Het
Zfp653 A T 9: 22,056,422 I529N probably damaging Het
Zfp948 T C 17: 21,586,842 S99P probably damaging Het
Zfyve9 A G 4: 108,693,311 probably benign Het
Zscan29 T C 2: 121,166,503 T246A probably damaging Het
Other mutations in Kctd7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01615:Kctd7 APN 5 130148135 missense probably damaging 1.00
IGL02185:Kctd7 APN 5 130152458 missense possibly damaging 0.73
R0027:Kctd7 UTSW 5 130152573 missense probably damaging 0.99
R0932:Kctd7 UTSW 5 130151669 critical splice acceptor site probably null
R2136:Kctd7 UTSW 5 130152366 missense probably damaging 0.99
R6009:Kctd7 UTSW 5 130145198 missense probably damaging 0.99
R6889:Kctd7 UTSW 5 130152501 missense probably benign 0.03
Predicted Primers PCR Primer
(F):5'- CCTGAAGTCGTCCCCTTGAACATTG -3'
(R):5'- TCAAACTGCACTGGGTGGGAAG -3'

Sequencing Primer
(F):5'- AACATTGGAGGGGCTCACTTTAC -3'
(R):5'- cacctttagtcccagcactc -3'
Posted On2014-01-29