Incidental Mutation 'R1376:Mast4'
ID 186271
Institutional Source Beutler Lab
Gene Symbol Mast4
Ensembl Gene ENSMUSG00000034751
Gene Name microtubule associated serine/threonine kinase family member 4
Synonyms 4930420O11Rik
MMRRC Submission 039440-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.226) question?
Stock # R1376 (G1)
Quality Score 225
Status Validated
Chromosome 13
Chromosomal Location 102868994-103471005 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 102872916 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Lysine to Glutamic Acid at position 1959 (K1959E)
Ref Sequence ENSEMBL: ENSMUSP00000131651 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000099202] [ENSMUST00000166726] [ENSMUST00000167058] [ENSMUST00000170878] [ENSMUST00000171791] [ENSMUST00000172138]
AlphaFold Q811L6
Predicted Effect probably benign
Transcript: ENSMUST00000099202
AA Change: K1974E

PolyPhen 2 Score 0.277 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000096808
Gene: ENSMUSG00000034751
AA Change: K1974E

DomainStartEndE-ValueType
low complexity region 13 38 N/A INTRINSIC
Pfam:DUF1908 76 353 2.2e-146 PFAM
S_TKc 391 664 4.13e-98 SMART
S_TK_X 665 729 3.79e-2 SMART
low complexity region 745 758 N/A INTRINSIC
low complexity region 818 831 N/A INTRINSIC
low complexity region 840 857 N/A INTRINSIC
low complexity region 925 960 N/A INTRINSIC
PDZ 970 1050 2.34e-15 SMART
low complexity region 1070 1087 N/A INTRINSIC
low complexity region 1111 1122 N/A INTRINSIC
low complexity region 1127 1139 N/A INTRINSIC
low complexity region 1142 1164 N/A INTRINSIC
low complexity region 1202 1219 N/A INTRINSIC
low complexity region 1290 1306 N/A INTRINSIC
low complexity region 1345 1361 N/A INTRINSIC
low complexity region 1937 1953 N/A INTRINSIC
low complexity region 1996 2010 N/A INTRINSIC
low complexity region 2150 2161 N/A INTRINSIC
low complexity region 2296 2307 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000166726
SMART Domains Protein: ENSMUSP00000132263
Gene: ENSMUSG00000034751

DomainStartEndE-ValueType
low complexity region 23 51 N/A INTRINSIC
Pfam:DUF1908 256 530 4.2e-145 PFAM
S_TKc 568 841 4.13e-98 SMART
S_TK_X 842 906 3.79e-2 SMART
low complexity region 922 935 N/A INTRINSIC
low complexity region 995 1008 N/A INTRINSIC
low complexity region 1035 1070 N/A INTRINSIC
PDZ 1080 1160 2.34e-15 SMART
low complexity region 1180 1201 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000167058
AA Change: K2151E

PolyPhen 2 Score 0.462 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000128464
Gene: ENSMUSG00000034751
AA Change: K2151E

DomainStartEndE-ValueType
low complexity region 23 51 N/A INTRINSIC
Pfam:DUF1908 256 529 5.1e-134 PFAM
S_TKc 568 841 4.13e-98 SMART
S_TK_X 842 906 3.79e-2 SMART
low complexity region 922 935 N/A INTRINSIC
low complexity region 995 1008 N/A INTRINSIC
low complexity region 1017 1034 N/A INTRINSIC
low complexity region 1102 1137 N/A INTRINSIC
PDZ 1147 1227 2.34e-15 SMART
low complexity region 1247 1264 N/A INTRINSIC
low complexity region 1288 1299 N/A INTRINSIC
low complexity region 1304 1316 N/A INTRINSIC
low complexity region 1319 1341 N/A INTRINSIC
low complexity region 1379 1396 N/A INTRINSIC
low complexity region 1467 1483 N/A INTRINSIC
low complexity region 1522 1538 N/A INTRINSIC
low complexity region 2114 2130 N/A INTRINSIC
low complexity region 2173 2187 N/A INTRINSIC
low complexity region 2327 2338 N/A INTRINSIC
low complexity region 2473 2484 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000170878
SMART Domains Protein: ENSMUSP00000127880
Gene: ENSMUSG00000021624

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
PDB:3T6Q|B 21 86 3e-38 PDB
SCOP:d1m0za_ 35 84 4e-4 SMART
Blast:LRR 51 75 1e-5 BLAST
Predicted Effect possibly damaging
Transcript: ENSMUST00000171791
AA Change: K1959E

PolyPhen 2 Score 0.462 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000131651
Gene: ENSMUSG00000034751
AA Change: K1959E

DomainStartEndE-ValueType
Pfam:DUF1908 64 338 1.2e-144 PFAM
S_TKc 376 649 4.13e-98 SMART
S_TK_X 650 714 3.79e-2 SMART
low complexity region 730 743 N/A INTRINSIC
low complexity region 803 816 N/A INTRINSIC
low complexity region 825 842 N/A INTRINSIC
low complexity region 910 945 N/A INTRINSIC
PDZ 955 1035 2.34e-15 SMART
low complexity region 1055 1072 N/A INTRINSIC
low complexity region 1096 1107 N/A INTRINSIC
low complexity region 1112 1124 N/A INTRINSIC
low complexity region 1127 1149 N/A INTRINSIC
low complexity region 1187 1204 N/A INTRINSIC
low complexity region 1275 1291 N/A INTRINSIC
low complexity region 1330 1346 N/A INTRINSIC
low complexity region 1922 1938 N/A INTRINSIC
low complexity region 1981 1995 N/A INTRINSIC
low complexity region 2135 2146 N/A INTRINSIC
low complexity region 2281 2292 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000172138
Predicted Effect probably benign
Transcript: ENSMUST00000194446
AA Change: K1983E

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 97.9%
  • 10x: 94.9%
  • 20x: 89.2%
Validation Efficiency 100% (29/29)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the microtubule-associated serine/threonine protein kinases. The proteins in this family contain a domain that gives the kinase the ability to determine its own scaffold to control the effects of their kinase activities. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Mar 2014]
PHENOTYPE: Mice homozygous for an ENU-induced allele exhibit malocclusion. [provided by MGI curators]
Allele List at MGI

All alleles(8) : Gene trapped(8)

Other mutations in this stock
Total: 34 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5730455P16Rik A T 11: 80,254,735 (GRCm39) I362N possibly damaging Het
9130023H24Rik A G 7: 127,836,182 (GRCm39) V137A probably benign Het
Adal A G 2: 120,983,011 (GRCm39) D177G probably damaging Het
Cdcp2 G T 4: 106,959,956 (GRCm39) V124F possibly damaging Het
Ceacam3 T C 7: 16,897,088 (GRCm39) C685R probably damaging Het
Cep295 T C 9: 15,252,164 (GRCm39) probably benign Het
Cfd T C 10: 79,727,986 (GRCm39) I174T possibly damaging Het
Dapk2 C G 9: 66,127,925 (GRCm39) R68G probably damaging Het
Ehd1 C T 19: 6,344,418 (GRCm39) T226M probably damaging Het
Elp5 A G 11: 69,865,916 (GRCm39) V120A probably benign Het
Fzd1 G A 5: 4,807,174 (GRCm39) T136M possibly damaging Het
Galntl5 G T 5: 25,391,286 (GRCm39) V62F probably benign Het
Gm11787 A G 4: 3,516,373 (GRCm39) noncoding transcript Het
Josd2 C A 7: 44,120,539 (GRCm39) P50H probably damaging Het
Lect2 T A 13: 56,690,577 (GRCm39) I133F probably damaging Het
Lifr A G 15: 7,214,245 (GRCm39) T700A probably benign Het
Lpl T C 8: 69,340,250 (GRCm39) W82R probably damaging Het
Man2a1 C T 17: 64,979,038 (GRCm39) R523C possibly damaging Het
Minar1 T C 9: 89,473,299 (GRCm39) T871A probably damaging Het
Or10ag57 A G 2: 87,218,162 (GRCm39) M38V probably benign Het
Or10ag58 C T 2: 87,264,903 (GRCm39) S24L possibly damaging Het
Pde4dip A G 3: 97,650,533 (GRCm39) V963A probably damaging Het
Pdgfd A G 9: 6,376,994 (GRCm39) I357V probably benign Het
Pold1 T C 7: 44,189,986 (GRCm39) D400G probably damaging Het
Ppp1r12a T C 10: 108,034,779 (GRCm39) I108T probably damaging Het
Rimbp2 G C 5: 128,847,355 (GRCm39) P931A possibly damaging Het
Rsf1 GCG GCGACG 7: 97,229,114 (GRCm39) probably benign Homo
Sec24a A C 11: 51,591,740 (GRCm39) probably benign Het
Sf3b1 A T 1: 55,058,424 (GRCm39) V55E probably damaging Het
Sult2a2 T C 7: 13,468,696 (GRCm39) V54A probably damaging Het
Taok3 T C 5: 117,404,026 (GRCm39) Y734H probably damaging Het
Tasor A G 14: 27,151,338 (GRCm39) K105E probably benign Het
Tuba3b A G 6: 145,564,500 (GRCm39) E90G possibly damaging Het
Vmn2r115 ATCTTCT ATCT 17: 23,578,962 (GRCm39) probably benign Het
Other mutations in Mast4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00703:Mast4 APN 13 102,907,275 (GRCm39) nonsense probably null
IGL00933:Mast4 APN 13 102,871,874 (GRCm39) missense probably damaging 0.97
IGL01113:Mast4 APN 13 102,910,744 (GRCm39) missense probably damaging 1.00
IGL01461:Mast4 APN 13 102,890,576 (GRCm39) missense probably damaging 1.00
IGL01569:Mast4 APN 13 102,897,523 (GRCm39) missense probably damaging 1.00
IGL01697:Mast4 APN 13 102,904,401 (GRCm39) missense probably damaging 1.00
IGL01725:Mast4 APN 13 102,887,020 (GRCm39) critical splice donor site probably null
IGL01734:Mast4 APN 13 102,874,123 (GRCm39) missense probably damaging 0.98
IGL01738:Mast4 APN 13 102,873,749 (GRCm39) missense probably damaging 1.00
IGL01739:Mast4 APN 13 102,910,781 (GRCm39) missense probably damaging 1.00
IGL02299:Mast4 APN 13 102,874,482 (GRCm39) missense probably benign 0.44
IGL02479:Mast4 APN 13 102,878,545 (GRCm39) missense probably damaging 1.00
IGL02485:Mast4 APN 13 102,872,004 (GRCm39) missense probably benign 0.02
IGL02528:Mast4 APN 13 102,990,331 (GRCm39) makesense probably null
IGL02850:Mast4 APN 13 102,890,740 (GRCm39) missense probably damaging 1.00
IGL02900:Mast4 APN 13 102,872,184 (GRCm39) missense probably benign
IGL03064:Mast4 APN 13 102,897,472 (GRCm39) nonsense probably null
IGL03124:Mast4 APN 13 102,874,753 (GRCm39) missense probably damaging 1.00
IGL03146:Mast4 APN 13 102,874,163 (GRCm39) missense probably benign 0.00
IGL03221:Mast4 APN 13 102,890,764 (GRCm39) missense possibly damaging 0.95
IGL03284:Mast4 APN 13 102,887,905 (GRCm39) missense probably damaging 1.00
IGL03406:Mast4 APN 13 102,873,615 (GRCm39) missense possibly damaging 0.46
buck UTSW 13 102,897,801 (GRCm39) critical splice donor site probably null
doe UTSW 13 103,042,185 (GRCm39) missense possibly damaging 0.85
skinnybones UTSW 13 102,941,149 (GRCm39) critical splice donor site probably null
BB010:Mast4 UTSW 13 102,909,071 (GRCm39) missense probably damaging 0.99
BB020:Mast4 UTSW 13 102,909,071 (GRCm39) missense probably damaging 0.99
FR4304:Mast4 UTSW 13 102,871,370 (GRCm39) utr 3 prime probably benign
FR4340:Mast4 UTSW 13 102,872,825 (GRCm39) small insertion probably benign
FR4340:Mast4 UTSW 13 102,871,365 (GRCm39) frame shift probably null
FR4548:Mast4 UTSW 13 102,872,826 (GRCm39) small insertion probably benign
FR4976:Mast4 UTSW 13 102,875,755 (GRCm39) frame shift probably null
FR4976:Mast4 UTSW 13 102,872,820 (GRCm39) small insertion probably benign
NA:Mast4 UTSW 13 102,878,565 (GRCm39) missense probably damaging 1.00
PIT4466001:Mast4 UTSW 13 102,941,226 (GRCm39) missense probably damaging 1.00
PIT4469001:Mast4 UTSW 13 102,941,226 (GRCm39) missense probably damaging 1.00
PIT4472001:Mast4 UTSW 13 102,941,226 (GRCm39) missense probably damaging 1.00
R0009:Mast4 UTSW 13 102,878,566 (GRCm39) missense probably damaging 1.00
R0063:Mast4 UTSW 13 103,470,723 (GRCm39) start gained probably benign
R0242:Mast4 UTSW 13 102,990,350 (GRCm39) missense probably damaging 1.00
R0310:Mast4 UTSW 13 102,890,669 (GRCm39) missense possibly damaging 0.94
R0395:Mast4 UTSW 13 102,871,781 (GRCm39) missense probably damaging 1.00
R0454:Mast4 UTSW 13 102,888,068 (GRCm39) missense probably damaging 1.00
R0646:Mast4 UTSW 13 102,895,252 (GRCm39) splice site probably benign
R0744:Mast4 UTSW 13 102,873,895 (GRCm39) missense probably damaging 0.98
R0883:Mast4 UTSW 13 102,990,408 (GRCm39) missense probably damaging 1.00
R0905:Mast4 UTSW 13 102,907,292 (GRCm39) missense probably damaging 0.99
R1023:Mast4 UTSW 13 102,872,004 (GRCm39) missense probably benign 0.02
R1281:Mast4 UTSW 13 102,887,086 (GRCm39) missense probably damaging 1.00
R1376:Mast4 UTSW 13 102,872,916 (GRCm39) missense possibly damaging 0.46
R1473:Mast4 UTSW 13 102,909,027 (GRCm39) missense probably damaging 1.00
R1572:Mast4 UTSW 13 102,873,431 (GRCm39) missense possibly damaging 0.51
R1575:Mast4 UTSW 13 102,875,771 (GRCm39) missense probably damaging 1.00
R1865:Mast4 UTSW 13 102,930,625 (GRCm39) missense probably damaging 1.00
R2050:Mast4 UTSW 13 102,887,917 (GRCm39) missense probably damaging 1.00
R2060:Mast4 UTSW 13 102,875,354 (GRCm39) missense probably damaging 1.00
R2062:Mast4 UTSW 13 102,895,601 (GRCm39) missense probably benign 0.18
R2106:Mast4 UTSW 13 102,887,054 (GRCm39) missense probably damaging 1.00
R2118:Mast4 UTSW 13 102,890,713 (GRCm39) missense probably damaging 1.00
R2143:Mast4 UTSW 13 102,871,983 (GRCm39) missense possibly damaging 0.89
R2256:Mast4 UTSW 13 102,872,259 (GRCm39) missense possibly damaging 0.62
R2261:Mast4 UTSW 13 102,934,715 (GRCm39) splice site probably benign
R2370:Mast4 UTSW 13 102,910,695 (GRCm39) missense probably damaging 1.00
R2504:Mast4 UTSW 13 102,875,147 (GRCm39) missense probably damaging 0.96
R2509:Mast4 UTSW 13 102,990,350 (GRCm39) missense probably damaging 1.00
R2842:Mast4 UTSW 13 102,872,939 (GRCm39) missense probably benign 0.01
R3087:Mast4 UTSW 13 102,990,434 (GRCm39) splice site probably benign
R3434:Mast4 UTSW 13 102,923,887 (GRCm39) missense probably damaging 1.00
R3435:Mast4 UTSW 13 102,923,887 (GRCm39) missense probably damaging 1.00
R3763:Mast4 UTSW 13 102,923,927 (GRCm39) missense probably damaging 1.00
R3826:Mast4 UTSW 13 102,875,319 (GRCm39) missense probably damaging 1.00
R3829:Mast4 UTSW 13 102,875,319 (GRCm39) missense probably damaging 1.00
R3830:Mast4 UTSW 13 102,875,319 (GRCm39) missense probably damaging 1.00
R3913:Mast4 UTSW 13 102,895,177 (GRCm39) missense probably damaging 1.00
R3914:Mast4 UTSW 13 102,875,829 (GRCm39) nonsense probably null
R4021:Mast4 UTSW 13 102,875,829 (GRCm39) nonsense probably null
R4022:Mast4 UTSW 13 102,990,377 (GRCm39) missense probably damaging 1.00
R4022:Mast4 UTSW 13 102,875,829 (GRCm39) nonsense probably null
R4210:Mast4 UTSW 13 102,875,713 (GRCm39) missense probably damaging 1.00
R4342:Mast4 UTSW 13 102,910,756 (GRCm39) missense probably damaging 1.00
R4580:Mast4 UTSW 13 102,873,766 (GRCm39) nonsense probably null
R4627:Mast4 UTSW 13 103,470,529 (GRCm39) missense possibly damaging 0.92
R4711:Mast4 UTSW 13 103,470,627 (GRCm39) missense probably benign 0.01
R4732:Mast4 UTSW 13 102,909,080 (GRCm39) missense probably damaging 0.99
R4733:Mast4 UTSW 13 102,909,080 (GRCm39) missense probably damaging 0.99
R4833:Mast4 UTSW 13 102,910,692 (GRCm39) critical splice donor site probably null
R4995:Mast4 UTSW 13 103,042,262 (GRCm39) intron probably benign
R5059:Mast4 UTSW 13 102,887,071 (GRCm39) missense probably damaging 1.00
R5073:Mast4 UTSW 13 102,875,391 (GRCm39) nonsense probably null
R5101:Mast4 UTSW 13 102,872,864 (GRCm39) missense probably benign 0.01
R5526:Mast4 UTSW 13 102,890,723 (GRCm39) missense possibly damaging 0.48
R5599:Mast4 UTSW 13 102,873,987 (GRCm39) missense probably damaging 1.00
R5673:Mast4 UTSW 13 102,930,580 (GRCm39) missense probably damaging 1.00
R5694:Mast4 UTSW 13 102,910,701 (GRCm39) nonsense probably null
R5906:Mast4 UTSW 13 102,872,252 (GRCm39) missense probably benign 0.31
R5908:Mast4 UTSW 13 102,874,764 (GRCm39) missense probably damaging 1.00
R5947:Mast4 UTSW 13 102,872,148 (GRCm39) missense probably benign
R5987:Mast4 UTSW 13 102,895,242 (GRCm39) missense probably damaging 1.00
R6143:Mast4 UTSW 13 102,990,391 (GRCm39) missense probably damaging 1.00
R6154:Mast4 UTSW 13 102,923,929 (GRCm39) missense probably damaging 1.00
R6169:Mast4 UTSW 13 102,923,929 (GRCm39) missense probably damaging 1.00
R6239:Mast4 UTSW 13 102,872,717 (GRCm39) missense probably benign 0.01
R6327:Mast4 UTSW 13 102,897,890 (GRCm39) missense probably damaging 1.00
R6356:Mast4 UTSW 13 102,872,493 (GRCm39) missense possibly damaging 0.80
R6432:Mast4 UTSW 13 103,042,185 (GRCm39) missense possibly damaging 0.85
R6522:Mast4 UTSW 13 102,897,801 (GRCm39) critical splice donor site probably null
R6667:Mast4 UTSW 13 102,874,004 (GRCm39) missense probably damaging 1.00
R6941:Mast4 UTSW 13 102,941,222 (GRCm39) missense probably damaging 1.00
R6968:Mast4 UTSW 13 102,941,155 (GRCm39) missense probably damaging 1.00
R6968:Mast4 UTSW 13 102,934,586 (GRCm39) missense probably damaging 1.00
R6970:Mast4 UTSW 13 102,941,155 (GRCm39) missense probably damaging 1.00
R6980:Mast4 UTSW 13 102,941,155 (GRCm39) missense probably damaging 1.00
R6991:Mast4 UTSW 13 102,941,155 (GRCm39) missense probably damaging 1.00
R6992:Mast4 UTSW 13 102,941,155 (GRCm39) missense probably damaging 1.00
R6993:Mast4 UTSW 13 102,872,482 (GRCm39) missense probably benign 0.28
R6993:Mast4 UTSW 13 102,941,155 (GRCm39) missense probably damaging 1.00
R7083:Mast4 UTSW 13 102,874,223 (GRCm39) missense probably damaging 1.00
R7241:Mast4 UTSW 13 103,470,508 (GRCm39) missense possibly damaging 0.87
R7242:Mast4 UTSW 13 102,874,986 (GRCm39) missense probably damaging 1.00
R7246:Mast4 UTSW 13 102,930,511 (GRCm39) missense probably damaging 1.00
R7332:Mast4 UTSW 13 102,887,932 (GRCm39) missense possibly damaging 0.61
R7453:Mast4 UTSW 13 102,941,149 (GRCm39) critical splice donor site probably null
R7514:Mast4 UTSW 13 102,923,934 (GRCm39) nonsense probably null
R7697:Mast4 UTSW 13 102,875,711 (GRCm39) missense probably damaging 1.00
R7820:Mast4 UTSW 13 102,890,596 (GRCm39) missense probably damaging 1.00
R7874:Mast4 UTSW 13 102,875,783 (GRCm39) missense probably damaging 1.00
R7933:Mast4 UTSW 13 102,909,071 (GRCm39) missense probably damaging 0.99
R8042:Mast4 UTSW 13 102,917,753 (GRCm39) missense probably damaging 0.96
R8060:Mast4 UTSW 13 102,874,184 (GRCm39) missense possibly damaging 0.89
R8172:Mast4 UTSW 13 103,089,633 (GRCm39) critical splice donor site probably null
R8206:Mast4 UTSW 13 102,872,247 (GRCm39) missense probably damaging 1.00
R8248:Mast4 UTSW 13 102,875,229 (GRCm39) missense probably damaging 1.00
R8283:Mast4 UTSW 13 102,895,177 (GRCm39) missense probably damaging 1.00
R8346:Mast4 UTSW 13 102,887,986 (GRCm39) missense probably damaging 0.99
R8434:Mast4 UTSW 13 102,897,900 (GRCm39) missense probably damaging 1.00
R8796:Mast4 UTSW 13 102,919,899 (GRCm39) missense probably benign 0.07
R8850:Mast4 UTSW 13 102,895,174 (GRCm39) missense probably damaging 1.00
R9012:Mast4 UTSW 13 102,934,606 (GRCm39) missense probably benign 0.05
R9375:Mast4 UTSW 13 102,917,753 (GRCm39) missense probably damaging 0.99
R9389:Mast4 UTSW 13 103,470,438 (GRCm39) missense probably benign 0.00
R9404:Mast4 UTSW 13 102,887,933 (GRCm39) missense probably damaging 1.00
R9520:Mast4 UTSW 13 102,925,532 (GRCm39) missense probably damaging 1.00
R9525:Mast4 UTSW 13 102,872,944 (GRCm39) missense probably benign 0.00
R9526:Mast4 UTSW 13 102,873,593 (GRCm39) missense probably benign 0.00
R9709:Mast4 UTSW 13 102,910,711 (GRCm39) missense probably damaging 1.00
R9790:Mast4 UTSW 13 102,890,705 (GRCm39) missense probably benign 0.01
R9791:Mast4 UTSW 13 102,890,705 (GRCm39) missense probably benign 0.01
RF005:Mast4 UTSW 13 102,872,815 (GRCm39) small insertion probably benign
RF015:Mast4 UTSW 13 102,875,755 (GRCm39) frame shift probably null
RF019:Mast4 UTSW 13 102,872,815 (GRCm39) small insertion probably benign
RF037:Mast4 UTSW 13 102,875,749 (GRCm39) small deletion probably benign
RF039:Mast4 UTSW 13 102,875,749 (GRCm39) small deletion probably benign
RF040:Mast4 UTSW 13 102,875,749 (GRCm39) small deletion probably benign
Z1088:Mast4 UTSW 13 102,875,027 (GRCm39) missense probably damaging 1.00
Z1176:Mast4 UTSW 13 102,874,968 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATGATTGAGACCCGACCTTCTCCC -3'
(R):5'- AAGCGAGAAAAGCTCTCCGCTG -3'

Sequencing Primer
(F):5'- AAATGTGTCCACTGGACCCTTG -3'
(R):5'- CCGCTGCCCCCTCTTTG -3'
Posted On 2014-05-09