Incidental Mutation 'R2138:Grid2'
ID 235952
Institutional Source Beutler Lab
Gene Symbol Grid2
Ensembl Gene ENSMUSG00000071424
Gene Name glutamate receptor, ionotropic, delta 2
Synonyms tpr, B230104L07Rik, GluRdelta2
MMRRC Submission 040141-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R2138 (G1)
Quality Score 225
Status Not validated
Chromosome 6
Chromosomal Location 63232860-64681307 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to A at 64322782 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Arginine to Glutamine at position 594 (R594Q)
Ref Sequence ENSEMBL: ENSMUSP00000093536 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000095852]
AlphaFold Q61625
Predicted Effect probably damaging
Transcript: ENSMUST00000095852
AA Change: R594Q

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000093536
Gene: ENSMUSG00000071424
AA Change: R594Q

DomainStartEndE-ValueType
Pfam:ANF_receptor 39 404 4.1e-41 PFAM
PBPe 442 807 5.98e-108 SMART
Lig_chan-Glu_bd 452 514 3.76e-24 SMART
transmembrane domain 830 852 N/A INTRINSIC
low complexity region 945 956 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the family of ionotropic glutamate receptors which are the predominant excitatory neurotransmitter receptors in the mammalian brain. The encoded protein is a multi-pass membrane protein that is expressed selectively in cerebellar Purkinje cells. A point mutation in the mouse ortholog, associated with the phenotype named 'lurcher', in the heterozygous state leads to ataxia resulting from selective, cell-autonomous apoptosis of cerebellar Purkinje cells during postnatal development. Mice homozygous for this mutation die shortly after birth from massive loss of mid- and hindbrain neurons during late embryogenesis. This protein also plays a role in synapse organization between parallel fibers and Purkinje cells. Alternate splicing results in multiple transcript variants encoding distinct isoforms. Mutations in this gene cause cerebellar ataxia in humans. [provided by RefSeq, Apr 2014]
PHENOTYPE: Homozygotes for multiple spontaneous and targeted null mutations exhibit ataxia and impaired locomotion associated with cerebellar Purkinje cell abnormalities and loss, and on some backgrounds, male infertility due to lack of zona penetration by sperm. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 74 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aamp A G 1: 74,323,122 (GRCm39) V6A probably benign Het
Abcc6 A G 7: 45,630,475 (GRCm39) F1262L probably damaging Het
Acot13 A T 13: 25,002,188 (GRCm39) probably null Het
Adgrv1 T C 13: 81,593,439 (GRCm39) I4183V probably benign Het
Aff4 T G 11: 53,263,339 (GRCm39) S120A possibly damaging Het
Afp A G 5: 90,647,506 (GRCm39) E250G probably damaging Het
Ankrd34b A T 13: 92,575,914 (GRCm39) D382V probably damaging Het
Arhgef19 A T 4: 140,978,111 (GRCm39) I577F probably damaging Het
Arl6 A G 16: 59,442,830 (GRCm39) probably benign Het
Atp2b2 A T 6: 113,773,268 (GRCm39) M333K probably benign Het
Atp8b3 C A 10: 80,362,939 (GRCm39) A635S possibly damaging Het
Baiap2 A G 11: 119,847,928 (GRCm39) T19A possibly damaging Het
Bcar3 A G 3: 122,306,645 (GRCm39) D206G probably damaging Het
Ccdc162 A T 10: 41,457,293 (GRCm39) M85K probably benign Het
Clec4a4 A G 6: 123,000,937 (GRCm39) N217D probably damaging Het
Csmd1 T C 8: 15,979,088 (GRCm39) Y2832C probably damaging Het
Cubn A G 2: 13,449,189 (GRCm39) I962T probably damaging Het
Dennd4a A G 9: 64,796,619 (GRCm39) Y852C probably damaging Het
Dhcr24 G T 4: 106,429,499 (GRCm39) E191* probably null Het
Dusp12 G A 1: 170,708,166 (GRCm39) Q114* probably null Het
Elfn2 G T 15: 78,558,238 (GRCm39) T103K probably benign Het
Eme1 A T 11: 94,539,018 (GRCm39) V314E probably damaging Het
Epb41l3 A G 17: 69,514,875 (GRCm39) E4G probably damaging Het
Exoc6b A T 6: 84,966,464 (GRCm39) L170Q probably damaging Het
Fbln5 C T 12: 101,728,179 (GRCm39) M261I probably benign Het
Fgf22 T C 10: 79,592,435 (GRCm39) V64A probably damaging Het
Gak C T 5: 108,754,743 (GRCm39) probably null Het
Gatad2b T A 3: 90,259,420 (GRCm39) S401R probably damaging Het
Gen1 A T 12: 11,291,622 (GRCm39) S722R probably damaging Het
Gm10754 A T 10: 97,518,132 (GRCm39) probably benign Het
Grm7 C A 6: 110,623,098 (GRCm39) N90K probably damaging Het
Herc1 G A 9: 66,377,589 (GRCm39) V3452M possibly damaging Het
Il22ra2 T A 10: 19,508,618 (GRCm39) F215L probably benign Het
Kank1 G A 19: 25,389,117 (GRCm39) G930D probably benign Het
Klra3 A T 6: 130,310,121 (GRCm39) V133D probably benign Het
Lims2 A G 18: 32,088,460 (GRCm39) E220G possibly damaging Het
Mbd3l2 A T 9: 18,356,254 (GRCm39) D193V probably damaging Het
Mbl1 T A 14: 40,875,648 (GRCm39) I34K possibly damaging Het
Mgam C T 6: 40,733,384 (GRCm39) P839S probably damaging Het
Mmp9 G T 2: 164,794,387 (GRCm39) E460* probably null Het
Mov10 T C 3: 104,711,558 (GRCm39) H316R probably benign Het
Ms4a18 A T 19: 10,974,695 (GRCm39) V332D possibly damaging Het
Myo15b T C 11: 115,774,633 (GRCm39) S2082P probably benign Het
Myrfl G A 10: 116,631,443 (GRCm39) T706I probably benign Het
Nampt C A 12: 32,888,421 (GRCm39) H191N possibly damaging Het
Niban1 G A 1: 151,572,002 (GRCm39) V316M probably damaging Het
Nphp3 A G 9: 103,903,102 (GRCm39) E693G possibly damaging Het
Obscn A T 11: 58,894,491 (GRCm39) Y1191* probably null Het
Or10z1 A T 1: 174,078,302 (GRCm39) probably null Het
Or1r1 A T 11: 73,875,129 (GRCm39) Y102N probably damaging Het
Or7a40 A G 16: 16,491,069 (GRCm39) Y259H probably damaging Het
Osbpl10 A G 9: 115,061,202 (GRCm39) N760S probably benign Het
Otof A G 5: 30,619,114 (GRCm39) V10A probably benign Het
Pkhd1l1 A C 15: 44,364,853 (GRCm39) E664A probably damaging Het
Pnp2 T C 14: 51,201,161 (GRCm39) S178P probably damaging Het
Pvr G A 7: 19,650,927 (GRCm39) T199I probably damaging Het
Rbp3 C T 14: 33,677,975 (GRCm39) T641M probably damaging Het
Rnaseh2b T C 14: 62,598,794 (GRCm39) V173A probably benign Het
Septin12 C T 16: 4,810,070 (GRCm39) R155H probably damaging Het
Slco6d1 G T 1: 98,371,385 (GRCm39) R290L probably benign Het
Snx32 A G 19: 5,546,157 (GRCm39) V335A probably damaging Het
Son T C 16: 91,456,260 (GRCm39) V1669A possibly damaging Het
Speer1f A T 5: 11,469,052 (GRCm39) R68* probably null Het
Tbata C T 10: 61,015,063 (GRCm39) T116I probably benign Het
Tdrd1 T A 19: 56,831,021 (GRCm39) S279T probably benign Het
Thsd7a A T 6: 12,471,072 (GRCm39) Y515* probably null Het
Tmem102 T G 11: 69,695,940 (GRCm39) L40F probably damaging Het
Tmem169 A G 1: 72,340,155 (GRCm39) N195S probably damaging Het
Tmem201 A T 4: 149,802,537 (GRCm39) S613T probably damaging Het
Tnfaip6 A T 2: 51,942,344 (GRCm39) I218F possibly damaging Het
Tube1 C A 10: 39,023,347 (GRCm39) H331Q probably benign Het
Wwc1 G A 11: 35,732,714 (GRCm39) T998I possibly damaging Het
Xpc A T 6: 91,475,104 (GRCm39) Y638* probably null Het
Zdhhc4 A T 5: 143,310,017 (GRCm39) Y80* probably null Het
Other mutations in Grid2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00580:Grid2 APN 6 64,322,573 (GRCm39) missense probably damaging 1.00
IGL00596:Grid2 APN 6 64,510,688 (GRCm39) missense possibly damaging 0.93
IGL01686:Grid2 APN 6 64,297,180 (GRCm39) missense probably benign 0.00
IGL01712:Grid2 APN 6 64,642,899 (GRCm39) missense possibly damaging 0.73
IGL02064:Grid2 APN 6 64,040,919 (GRCm39) missense probably benign 0.29
IGL02216:Grid2 APN 6 64,322,650 (GRCm39) missense probably damaging 0.96
IGL02563:Grid2 APN 6 64,322,857 (GRCm39) missense possibly damaging 0.94
IGL02685:Grid2 APN 6 64,322,800 (GRCm39) missense possibly damaging 0.50
IGL03129:Grid2 APN 6 64,040,888 (GRCm39) missense probably damaging 0.98
IGL03324:Grid2 APN 6 64,406,806 (GRCm39) missense possibly damaging 0.88
IGL03395:Grid2 APN 6 63,886,053 (GRCm39) missense possibly damaging 0.94
crawler UTSW 6 64,406,678 (GRCm39) nonsense probably null
swagger UTSW 6 64,372,263 (GRCm39) synonymous probably benign
R0133:Grid2 UTSW 6 64,297,116 (GRCm39) missense probably damaging 1.00
R0147:Grid2 UTSW 6 64,510,571 (GRCm39) missense probably benign
R0193:Grid2 UTSW 6 64,040,937 (GRCm39) missense possibly damaging 0.64
R0370:Grid2 UTSW 6 64,322,718 (GRCm39) missense possibly damaging 0.75
R0399:Grid2 UTSW 6 64,643,036 (GRCm39) missense probably benign 0.33
R0600:Grid2 UTSW 6 63,480,419 (GRCm39) missense probably benign 0.38
R0717:Grid2 UTSW 6 64,643,259 (GRCm39) missense possibly damaging 0.96
R1524:Grid2 UTSW 6 64,406,738 (GRCm39) missense possibly damaging 0.92
R1555:Grid2 UTSW 6 64,406,668 (GRCm39) missense possibly damaging 0.87
R1572:Grid2 UTSW 6 64,406,678 (GRCm39) nonsense probably null
R1762:Grid2 UTSW 6 64,510,638 (GRCm39) missense probably damaging 0.98
R1944:Grid2 UTSW 6 63,886,045 (GRCm39) missense probably damaging 1.00
R1961:Grid2 UTSW 6 63,885,877 (GRCm39) missense probably damaging 1.00
R1969:Grid2 UTSW 6 63,885,902 (GRCm39) nonsense probably null
R3500:Grid2 UTSW 6 63,480,383 (GRCm39) missense probably damaging 0.97
R3547:Grid2 UTSW 6 64,297,005 (GRCm39) missense probably damaging 0.97
R3845:Grid2 UTSW 6 64,322,826 (GRCm39) missense possibly damaging 0.62
R4124:Grid2 UTSW 6 63,480,417 (GRCm39) missense probably benign 0.41
R4273:Grid2 UTSW 6 63,886,029 (GRCm39) missense probably damaging 1.00
R4591:Grid2 UTSW 6 64,297,086 (GRCm39) missense probably damaging 1.00
R4701:Grid2 UTSW 6 64,642,899 (GRCm39) missense probably benign 0.27
R4721:Grid2 UTSW 6 64,643,185 (GRCm39) missense probably benign 0.33
R4755:Grid2 UTSW 6 63,885,972 (GRCm39) missense probably benign 0.04
R4869:Grid2 UTSW 6 64,406,724 (GRCm39) missense probably damaging 1.00
R5083:Grid2 UTSW 6 64,297,136 (GRCm39) nonsense probably null
R5091:Grid2 UTSW 6 64,053,862 (GRCm39) missense probably benign 0.07
R5117:Grid2 UTSW 6 63,233,917 (GRCm39) missense probably benign 0.15
R5128:Grid2 UTSW 6 64,642,982 (GRCm39) missense probably benign 0.01
R5386:Grid2 UTSW 6 63,908,089 (GRCm39) missense probably damaging 0.99
R5404:Grid2 UTSW 6 63,907,894 (GRCm39) missense probably damaging 0.99
R5534:Grid2 UTSW 6 63,480,345 (GRCm39) missense probably benign
R5626:Grid2 UTSW 6 64,053,929 (GRCm39) critical splice donor site probably null
R5699:Grid2 UTSW 6 63,885,975 (GRCm39) missense probably damaging 0.99
R5700:Grid2 UTSW 6 64,071,416 (GRCm39) missense possibly damaging 0.95
R5876:Grid2 UTSW 6 64,640,146 (GRCm39) missense probably damaging 1.00
R6446:Grid2 UTSW 6 64,322,577 (GRCm39) missense probably damaging 1.00
R6694:Grid2 UTSW 6 63,908,031 (GRCm39) missense possibly damaging 0.92
R6697:Grid2 UTSW 6 63,908,031 (GRCm39) missense possibly damaging 0.92
R6699:Grid2 UTSW 6 63,908,031 (GRCm39) missense possibly damaging 0.92
R6767:Grid2 UTSW 6 63,907,999 (GRCm39) missense probably benign 0.01
R6895:Grid2 UTSW 6 64,372,283 (GRCm39) missense probably damaging 0.99
R6999:Grid2 UTSW 6 64,053,893 (GRCm39) missense possibly damaging 0.80
R7053:Grid2 UTSW 6 64,677,402 (GRCm39) missense unknown
R7126:Grid2 UTSW 6 64,053,794 (GRCm39) missense probably damaging 0.99
R7432:Grid2 UTSW 6 64,252,854 (GRCm39) missense possibly damaging 0.46
R7553:Grid2 UTSW 6 64,053,925 (GRCm39) missense possibly damaging 0.95
R7619:Grid2 UTSW 6 63,908,085 (GRCm39) missense possibly damaging 0.71
R7997:Grid2 UTSW 6 64,297,120 (GRCm39) missense possibly damaging 0.89
R8112:Grid2 UTSW 6 63,885,891 (GRCm39) missense probably damaging 0.99
R8296:Grid2 UTSW 6 63,233,929 (GRCm39) critical splice donor site probably null
R8320:Grid2 UTSW 6 63,233,917 (GRCm39) missense probably benign 0.15
R8467:Grid2 UTSW 6 64,510,635 (GRCm39) missense probably benign 0.01
R8691:Grid2 UTSW 6 63,480,321 (GRCm39) missense probably damaging 0.97
R8890:Grid2 UTSW 6 63,233,923 (GRCm39) missense probably benign
R8965:Grid2 UTSW 6 64,296,990 (GRCm39) missense probably damaging 1.00
R8968:Grid2 UTSW 6 64,643,139 (GRCm39) missense probably benign 0.14
R9220:Grid2 UTSW 6 63,885,888 (GRCm39) missense probably damaging 1.00
R9371:Grid2 UTSW 6 64,677,506 (GRCm39) missense unknown
R9653:Grid2 UTSW 6 63,907,968 (GRCm39) missense possibly damaging 0.75
Z1176:Grid2 UTSW 6 64,640,212 (GRCm39) missense probably benign 0.03
Z1176:Grid2 UTSW 6 63,885,863 (GRCm39) missense possibly damaging 0.76
Z1177:Grid2 UTSW 6 64,322,841 (GRCm39) missense probably damaging 1.00
Z1177:Grid2 UTSW 6 64,322,840 (GRCm39) nonsense probably null
Predicted Primers PCR Primer
(F):5'- CCAGACCGGGAGAATGTTGTAG -3'
(R):5'- TGTTATCTTCTGAGCACTGCTG -3'

Sequencing Primer
(F):5'- GATTTTACAACACGCTACATGGAC -3'
(R):5'- CTGAGCACTGCTGTGAAGATC -3'
Posted On 2014-10-01