Incidental Mutation 'R3878:Fam214b'
ID276937
Institutional Source Beutler Lab
Gene Symbol Fam214b
Ensembl Gene ENSMUSG00000036002
Gene Namefamily with sequence similarity 214, member B
SynonymsB230312A22Rik
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.300) question?
Stock #R3878 (G1)
Quality Score225
Status Not validated
Chromosome4
Chromosomal Location43032414-43046220 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 43035867 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Proline at position 288 (H288P)
Ref Sequence ENSEMBL: ENSMUSP00000103593 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030169] [ENSMUST00000036462] [ENSMUST00000107956] [ENSMUST00000107957] [ENSMUST00000107958] [ENSMUST00000107959] [ENSMUST00000124155] [ENSMUST00000135067] [ENSMUST00000136326] [ENSMUST00000138030] [ENSMUST00000144999] [ENSMUST00000152846]
Predicted Effect probably benign
Transcript: ENSMUST00000030169
SMART Domains Protein: ENSMUSP00000030169
Gene: ENSMUSG00000028455

DomainStartEndE-ValueType
low complexity region 2 16 N/A INTRINSIC
PHB 36 194 1.47e-57 SMART
coiled coil region 231 252 N/A INTRINSIC
Pfam:Band_7_C 259 321 2.1e-28 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000036462
AA Change: H288P

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000038177
Gene: ENSMUSG00000036002
AA Change: H288P

DomainStartEndE-ValueType
low complexity region 100 112 N/A INTRINSIC
low complexity region 229 239 N/A INTRINSIC
low complexity region 307 326 N/A INTRINSIC
low complexity region 327 345 N/A INTRINSIC
DUF4210 348 406 9.25e-30 SMART
Pfam:Chromosome_seg 479 537 8.8e-22 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000107956
AA Change: H288P

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000103590
Gene: ENSMUSG00000036002
AA Change: H288P

DomainStartEndE-ValueType
low complexity region 100 112 N/A INTRINSIC
low complexity region 229 239 N/A INTRINSIC
low complexity region 307 326 N/A INTRINSIC
low complexity region 327 345 N/A INTRINSIC
DUF4210 348 406 9.25e-30 SMART
Pfam:Chromosome_seg 479 537 8.8e-22 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000107957
AA Change: H288P

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000103591
Gene: ENSMUSG00000036002
AA Change: H288P

DomainStartEndE-ValueType
low complexity region 100 112 N/A INTRINSIC
low complexity region 229 239 N/A INTRINSIC
low complexity region 307 326 N/A INTRINSIC
low complexity region 327 345 N/A INTRINSIC
DUF4210 348 406 9.25e-30 SMART
Pfam:Chromosome_seg 479 537 8.8e-22 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000107958
AA Change: H288P

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000103592
Gene: ENSMUSG00000036002
AA Change: H288P

DomainStartEndE-ValueType
low complexity region 100 112 N/A INTRINSIC
low complexity region 229 239 N/A INTRINSIC
low complexity region 307 326 N/A INTRINSIC
low complexity region 327 345 N/A INTRINSIC
DUF4210 348 406 9.25e-30 SMART
Pfam:Chromosome_seg 479 537 8.8e-22 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000107959
AA Change: H288P

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000103593
Gene: ENSMUSG00000036002
AA Change: H288P

DomainStartEndE-ValueType
low complexity region 100 112 N/A INTRINSIC
low complexity region 229 239 N/A INTRINSIC
low complexity region 307 326 N/A INTRINSIC
low complexity region 327 345 N/A INTRINSIC
DUF4210 348 406 9.25e-30 SMART
Pfam:Chromosome_seg 480 537 8.1e-21 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123465
Predicted Effect probably benign
Transcript: ENSMUST00000124155
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126026
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127645
Predicted Effect probably damaging
Transcript: ENSMUST00000135067
AA Change: H288P

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000122882
Gene: ENSMUSG00000036002
AA Change: H288P

DomainStartEndE-ValueType
low complexity region 100 112 N/A INTRINSIC
low complexity region 229 239 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000136326
SMART Domains Protein: ENSMUSP00000117586
Gene: ENSMUSG00000028455

DomainStartEndE-ValueType
PHB 1 148 1.33e-37 SMART
coiled coil region 185 206 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000138030
SMART Domains Protein: ENSMUSP00000118465
Gene: ENSMUSG00000028455

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
PHB 42 200 1.47e-57 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140998
Predicted Effect probably benign
Transcript: ENSMUST00000144999
Predicted Effect probably benign
Transcript: ENSMUST00000152846
SMART Domains Protein: ENSMUSP00000118228
Gene: ENSMUSG00000036002

DomainStartEndE-ValueType
low complexity region 100 112 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000180854
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.3%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700020A23Rik C T 2: 130,405,640 T32M probably benign Het
4930402H24Rik T C 2: 130,778,503 R237G possibly damaging Het
A2ml1 T C 6: 128,554,361 S915G probably benign Het
Ablim1 T C 19: 57,037,210 probably null Het
Cadm2 C T 16: 66,815,441 E78K probably damaging Het
Ceacam5 C T 7: 17,750,581 P416L probably damaging Het
Chsy3 T C 18: 59,409,773 F661S probably damaging Het
Clstn3 G A 6: 124,457,942 T338I probably damaging Het
Ctif A G 18: 75,519,977 I403T probably damaging Het
Eprs T A 1: 185,415,953 probably null Het
Frs2 A C 10: 117,078,910 S35A probably benign Het
Gpr155 C T 2: 73,368,392 W394* probably null Het
Ift140 G A 17: 25,028,944 V259M probably benign Het
Igkv9-124 A T 6: 67,942,207 S74T probably benign Het
Krt14 C T 11: 100,207,089 V123M possibly damaging Het
Mcm2 G A 6: 88,893,008 R60C probably damaging Het
Nebl T C 2: 17,393,252 T457A possibly damaging Het
Nlrp4g A G 9: 124,349,362 noncoding transcript Het
Nsa2 C G 13: 97,132,034 G175A probably benign Het
Olfr1090 T C 2: 86,754,628 T37A probably benign Het
Pax1 A T 2: 147,362,308 probably benign Het
Pdzd2 T C 15: 12,376,176 E1291G probably benign Het
Relb G A 7: 19,617,844 H115Y probably damaging Het
Rnase10 A G 14: 51,009,432 E52G probably damaging Het
Sla2 G A 2: 156,875,942 R137C probably damaging Het
Slc14a2 C T 18: 78,159,074 V614I probably benign Het
Slc20a2 T C 8: 22,568,383 L645P possibly damaging Het
Smoc2 A G 17: 14,325,617 D56G probably damaging Het
Szt2 A G 4: 118,390,585 S789P probably damaging Het
Tenm2 A G 11: 36,139,574 probably null Het
Tm9sf3 A G 19: 41,246,713 V169A probably damaging Het
Trbv13-1 C T 6: 41,116,388 T86I probably benign Het
Trim24 A G 6: 37,964,773 D886G probably benign Het
Trim33 A G 3: 103,352,005 I1003M probably damaging Het
Trim37 T C 11: 87,206,002 V777A probably benign Het
Ttc7 A C 17: 87,370,738 probably benign Het
Ttn T C 2: 76,766,020 D11856G possibly damaging Het
Vmn1r226 A T 17: 20,687,998 D164V possibly damaging Het
Vmn1r34 G A 6: 66,637,568 T62I possibly damaging Het
Wapl T C 14: 34,692,147 L322P probably damaging Het
Zfp62 A G 11: 49,215,133 D17G probably damaging Het
Other mutations in Fam214b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02268:Fam214b APN 4 43036468 nonsense probably null
IGL02810:Fam214b APN 4 43034429 missense probably damaging 1.00
R0049:Fam214b UTSW 4 43036441 missense probably benign 0.30
R0049:Fam214b UTSW 4 43036441 missense probably benign 0.30
R0565:Fam214b UTSW 4 43034647 unclassified probably benign
R0627:Fam214b UTSW 4 43036242 missense probably damaging 1.00
R1121:Fam214b UTSW 4 43034947 missense probably damaging 1.00
R2395:Fam214b UTSW 4 43035964 nonsense probably null
R2853:Fam214b UTSW 4 43036293 missense probably benign
R4688:Fam214b UTSW 4 43034663 missense probably damaging 1.00
R6467:Fam214b UTSW 4 43033687 missense probably damaging 1.00
R6556:Fam214b UTSW 4 43033896 missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- TTCCCTTCGAACTCTCCGGAAG -3'
(R):5'- ACACACTTGACACTGATTTGCAC -3'

Sequencing Primer
(F):5'- TGAGTCCAACACTGCACCTGG -3'
(R):5'- GACACTGATTTGCACAATCTTGC -3'
Posted On2015-04-06