Incidental Mutation 'R3878:Rnase10'
ID276960
Institutional Source Beutler Lab
Gene Symbol Rnase10
Ensembl Gene ENSMUSG00000021872
Gene Nameribonuclease, RNase A family, 10 (non-active)
Synonyms4930474F22Rik
Accession Numbers
Is this an essential gene? Not available question?
Stock #R3878 (G1)
Quality Score225
Status Not validated
Chromosome14
Chromosomal Location51007751-51010758 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 51009432 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 52 (E52G)
Ref Sequence ENSEMBL: ENSMUSP00000131065 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022424] [ENSMUST00000164632]
Predicted Effect possibly damaging
Transcript: ENSMUST00000022424
AA Change: E89G

PolyPhen 2 Score 0.935 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000022424
Gene: ENSMUSG00000021872
AA Change: E89G

DomainStartEndE-ValueType
transmembrane domain 40 62 N/A INTRINSIC
low complexity region 87 98 N/A INTRINSIC
Pfam:RnaseA 132 244 2.2e-21 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000164632
AA Change: E52G

PolyPhen 2 Score 0.968 (Sensitivity: 0.77; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000131065
Gene: ENSMUSG00000021872
AA Change: E52G

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
low complexity region 50 61 N/A INTRINSIC
Pfam:RnaseA 91 208 1.4e-21 PFAM
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.3%
Validation Efficiency
MGI Phenotype PHENOTYPE: Homozygous disruption of this gene leads to decreased bone mineral density, alterations in B cell, T cell and NK cell number, and abnormal circulating glucose, creatinine, chloride and serum albumin levels. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700020A23Rik C T 2: 130,405,640 T32M probably benign Het
4930402H24Rik T C 2: 130,778,503 R237G possibly damaging Het
A2ml1 T C 6: 128,554,361 S915G probably benign Het
Ablim1 T C 19: 57,037,210 probably null Het
Cadm2 C T 16: 66,815,441 E78K probably damaging Het
Ceacam5 C T 7: 17,750,581 P416L probably damaging Het
Chsy3 T C 18: 59,409,773 F661S probably damaging Het
Clstn3 G A 6: 124,457,942 T338I probably damaging Het
Ctif A G 18: 75,519,977 I403T probably damaging Het
Eprs T A 1: 185,415,953 probably null Het
Fam214b T G 4: 43,035,867 H288P probably damaging Het
Frs2 A C 10: 117,078,910 S35A probably benign Het
Gpr155 C T 2: 73,368,392 W394* probably null Het
Ift140 G A 17: 25,028,944 V259M probably benign Het
Igkv9-124 A T 6: 67,942,207 S74T probably benign Het
Krt14 C T 11: 100,207,089 V123M possibly damaging Het
Mcm2 G A 6: 88,893,008 R60C probably damaging Het
Nebl T C 2: 17,393,252 T457A possibly damaging Het
Nlrp4g A G 9: 124,349,362 noncoding transcript Het
Nsa2 C G 13: 97,132,034 G175A probably benign Het
Olfr1090 T C 2: 86,754,628 T37A probably benign Het
Pax1 A T 2: 147,362,308 probably benign Het
Pdzd2 T C 15: 12,376,176 E1291G probably benign Het
Relb G A 7: 19,617,844 H115Y probably damaging Het
Sla2 G A 2: 156,875,942 R137C probably damaging Het
Slc14a2 C T 18: 78,159,074 V614I probably benign Het
Slc20a2 T C 8: 22,568,383 L645P possibly damaging Het
Smoc2 A G 17: 14,325,617 D56G probably damaging Het
Szt2 A G 4: 118,390,585 S789P probably damaging Het
Tenm2 A G 11: 36,139,574 probably null Het
Tm9sf3 A G 19: 41,246,713 V169A probably damaging Het
Trbv13-1 C T 6: 41,116,388 T86I probably benign Het
Trim24 A G 6: 37,964,773 D886G probably benign Het
Trim33 A G 3: 103,352,005 I1003M probably damaging Het
Trim37 T C 11: 87,206,002 V777A probably benign Het
Ttc7 A C 17: 87,370,738 probably benign Het
Ttn T C 2: 76,766,020 D11856G possibly damaging Het
Vmn1r226 A T 17: 20,687,998 D164V possibly damaging Het
Vmn1r34 G A 6: 66,637,568 T62I possibly damaging Het
Wapl T C 14: 34,692,147 L322P probably damaging Het
Zfp62 A G 11: 49,215,133 D17G probably damaging Het
Other mutations in Rnase10
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00161:Rnase10 APN 14 51009781 missense possibly damaging 0.91
IGL01534:Rnase10 APN 14 51007979 missense probably benign 0.00
IGL02082:Rnase10 APN 14 51009399 missense probably damaging 1.00
IGL02661:Rnase10 APN 14 51009816 missense probably damaging 1.00
R1254:Rnase10 UTSW 14 51009626 missense probably damaging 0.99
R1989:Rnase10 UTSW 14 51009638 missense probably benign 0.03
R5405:Rnase10 UTSW 14 51009860 missense probably damaging 1.00
R5942:Rnase10 UTSW 14 51009278 missense probably benign 0.08
R6107:Rnase10 UTSW 14 51009294 missense possibly damaging 0.89
Predicted Primers PCR Primer
(F):5'- CAGGGGCCAGAGTTTATCTC -3'
(R):5'- ATGGTATTACAGTCCCTGACACTC -3'

Sequencing Primer
(F):5'- GAGTTTATCTCTACATCACGCCTTC -3'
(R):5'- GTATTACAGTCCCTGACACTCAAGTC -3'
Posted On2015-04-06