Incidental Mutation 'R3878:Trim33'
ID276936
Institutional Source Beutler Lab
Gene Symbol Trim33
Ensembl Gene ENSMUSG00000033014
Gene Nametripartite motif-containing 33
Synonymsectodermin, Ecto, 8030451N04Rik, Tif1g
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R3878 (G1)
Quality Score225
Status Not validated
Chromosome3
Chromosomal Location103279293-103358775 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 103352005 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Methionine at position 1003 (I1003M)
Ref Sequence ENSEMBL: ENSMUSP00000102473 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029444] [ENSMUST00000106860] [ENSMUST00000198706]
Predicted Effect possibly damaging
Transcript: ENSMUST00000029444
AA Change: I1003M

PolyPhen 2 Score 0.872 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000029444
Gene: ENSMUSG00000033014
AA Change: I1003M

DomainStartEndE-ValueType
low complexity region 6 31 N/A INTRINSIC
low complexity region 33 134 N/A INTRINSIC
PHD 138 199 9.85e0 SMART
RING 139 198 2.12e-8 SMART
BBOX 226 273 1.24e-9 SMART
RING 231 293 2.01e0 SMART
BBOX 285 326 1.54e-10 SMART
BBC 333 459 7.55e-45 SMART
low complexity region 540 583 N/A INTRINSIC
low complexity region 731 773 N/A INTRINSIC
low complexity region 820 837 N/A INTRINSIC
PHD 902 945 4.15e-11 SMART
BROMO 972 1095 3.74e-30 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000106860
AA Change: I1003M

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000102473
Gene: ENSMUSG00000033014
AA Change: I1003M

DomainStartEndE-ValueType
low complexity region 6 31 N/A INTRINSIC
low complexity region 33 134 N/A INTRINSIC
PHD 138 199 9.85e0 SMART
RING 139 198 2.12e-8 SMART
BBOX 226 273 1.24e-9 SMART
RING 231 293 2.01e0 SMART
BBOX 285 326 1.54e-10 SMART
BBC 333 459 7.55e-45 SMART
low complexity region 540 583 N/A INTRINSIC
low complexity region 731 773 N/A INTRINSIC
low complexity region 820 837 N/A INTRINSIC
PHD 902 945 4.15e-11 SMART
BROMO 972 1078 3.52e-35 SMART
Predicted Effect unknown
Transcript: ENSMUST00000197365
AA Change: I196M
Predicted Effect probably benign
Transcript: ENSMUST00000198706
SMART Domains Protein: ENSMUSP00000142585
Gene: ENSMUSG00000033014

DomainStartEndE-ValueType
Blast:BBC 1 30 9e-11 BLAST
low complexity region 111 154 N/A INTRINSIC
low complexity region 302 344 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is thought to be a transcriptional corepressor. However, molecules that interact with this protein have not yet been identified. The protein is a member of the tripartite motif family. This motif includes three zinc-binding domains, a RING, a B-box type 1 and a B-box type 2, and a coiled-coil region. Three alternatively spliced transcript variants for this gene have been described, however, the full-length nature of one variant has not been determined. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit embryonic lethality prior to E9.5 with abnormal embryonic development. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700020A23Rik C T 2: 130,405,640 T32M probably benign Het
4930402H24Rik T C 2: 130,778,503 R237G possibly damaging Het
A2ml1 T C 6: 128,554,361 S915G probably benign Het
Ablim1 T C 19: 57,037,210 probably null Het
Cadm2 C T 16: 66,815,441 E78K probably damaging Het
Ceacam5 C T 7: 17,750,581 P416L probably damaging Het
Chsy3 T C 18: 59,409,773 F661S probably damaging Het
Clstn3 G A 6: 124,457,942 T338I probably damaging Het
Ctif A G 18: 75,519,977 I403T probably damaging Het
Eprs T A 1: 185,415,953 probably null Het
Fam214b T G 4: 43,035,867 H288P probably damaging Het
Frs2 A C 10: 117,078,910 S35A probably benign Het
Gpr155 C T 2: 73,368,392 W394* probably null Het
Ift140 G A 17: 25,028,944 V259M probably benign Het
Igkv9-124 A T 6: 67,942,207 S74T probably benign Het
Krt14 C T 11: 100,207,089 V123M possibly damaging Het
Mcm2 G A 6: 88,893,008 R60C probably damaging Het
Nebl T C 2: 17,393,252 T457A possibly damaging Het
Nlrp4g A G 9: 124,349,362 noncoding transcript Het
Nsa2 C G 13: 97,132,034 G175A probably benign Het
Olfr1090 T C 2: 86,754,628 T37A probably benign Het
Pax1 A T 2: 147,362,308 probably benign Het
Pdzd2 T C 15: 12,376,176 E1291G probably benign Het
Relb G A 7: 19,617,844 H115Y probably damaging Het
Rnase10 A G 14: 51,009,432 E52G probably damaging Het
Sla2 G A 2: 156,875,942 R137C probably damaging Het
Slc14a2 C T 18: 78,159,074 V614I probably benign Het
Slc20a2 T C 8: 22,568,383 L645P possibly damaging Het
Smoc2 A G 17: 14,325,617 D56G probably damaging Het
Szt2 A G 4: 118,390,585 S789P probably damaging Het
Tenm2 A G 11: 36,139,574 probably null Het
Tm9sf3 A G 19: 41,246,713 V169A probably damaging Het
Trbv13-1 C T 6: 41,116,388 T86I probably benign Het
Trim24 A G 6: 37,964,773 D886G probably benign Het
Trim37 T C 11: 87,206,002 V777A probably benign Het
Ttc7 A C 17: 87,370,738 probably benign Het
Ttn T C 2: 76,766,020 D11856G possibly damaging Het
Vmn1r226 A T 17: 20,687,998 D164V possibly damaging Het
Vmn1r34 G A 6: 66,637,568 T62I possibly damaging Het
Wapl T C 14: 34,692,147 L322P probably damaging Het
Zfp62 A G 11: 49,215,133 D17G probably damaging Het
Other mutations in Trim33
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00502:Trim33 APN 3 103330182 missense probably benign 0.44
IGL00981:Trim33 APN 3 103351995 splice site probably benign
IGL01010:Trim33 APN 3 103346715 nonsense probably null
IGL01025:Trim33 APN 3 103353918 utr 3 prime probably benign
IGL01082:Trim33 APN 3 103326859 missense possibly damaging 0.49
IGL02245:Trim33 APN 3 103346770 critical splice donor site probably null
IGL02291:Trim33 APN 3 103326865 missense probably damaging 1.00
IGL03248:Trim33 APN 3 103310973 unclassified probably benign
IGL03400:Trim33 APN 3 103329143 missense probably damaging 0.99
abilene UTSW 3 103321559 missense probably damaging 0.99
Peaked UTSW 3 103337532 critical splice donor site probably null
R0143:Trim33 UTSW 3 103352101 missense probably benign 0.00
R0471:Trim33 UTSW 3 103326901 missense possibly damaging 0.46
R0513:Trim33 UTSW 3 103310384 missense probably damaging 1.00
R0573:Trim33 UTSW 3 103351990 splice site probably benign
R0586:Trim33 UTSW 3 103310344 missense probably damaging 0.99
R1103:Trim33 UTSW 3 103310885 missense probably damaging 0.98
R1157:Trim33 UTSW 3 103353830 missense probably damaging 1.00
R1328:Trim33 UTSW 3 103353597 missense possibly damaging 0.86
R1331:Trim33 UTSW 3 103310354 missense probably damaging 0.99
R1385:Trim33 UTSW 3 103310950 missense possibly damaging 0.46
R1397:Trim33 UTSW 3 103310434 unclassified probably benign
R1785:Trim33 UTSW 3 103329220 frame shift probably null
R1848:Trim33 UTSW 3 103324640 unclassified probably benign
R1903:Trim33 UTSW 3 103337444 missense probably damaging 1.00
R3404:Trim33 UTSW 3 103321559 missense probably damaging 0.99
R4156:Trim33 UTSW 3 103310314 missense possibly damaging 0.94
R4281:Trim33 UTSW 3 103329086 missense probably damaging 0.99
R4570:Trim33 UTSW 3 103330165 missense probably damaging 0.96
R4809:Trim33 UTSW 3 103329256 missense possibly damaging 0.91
R4904:Trim33 UTSW 3 103331647 missense possibly damaging 0.46
R5168:Trim33 UTSW 3 103341681 nonsense probably null
R5458:Trim33 UTSW 3 103330180 missense possibly damaging 0.64
R5910:Trim33 UTSW 3 103344576 missense probably damaging 1.00
R6195:Trim33 UTSW 3 103337532 critical splice donor site probably null
R6331:Trim33 UTSW 3 103341609 missense probably benign 0.00
R6636:Trim33 UTSW 3 103353719 missense probably damaging 1.00
R6642:Trim33 UTSW 3 103337514 missense probably damaging 0.99
R6783:Trim33 UTSW 3 103352087 missense probably damaging 1.00
R6856:Trim33 UTSW 3 103352049 missense probably damaging 0.97
Predicted Primers PCR Primer
(F):5'- AGCATGTATCCTGCAGTAAGATCTG -3'
(R):5'- GCCAATACTCTATAGGTTGGAAGC -3'

Sequencing Primer
(F):5'- CCTGCAGTAAGATCTGATAGTCAAG -3'
(R):5'- ACTCTATAGGTTGGAAGCTAACATAC -3'
Posted On2015-04-06