Incidental Mutation 'R4056:5730455P16Rik'
ID314258
Institutional Source Beutler Lab
Gene Symbol 5730455P16Rik
Ensembl Gene ENSMUSG00000057181
Gene NameRIKEN cDNA 5730455P16 gene
Synonyms
MMRRC Submission 041617-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.650) question?
Stock #R4056 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location80360492-80378034 bp(-) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) T to A at 80375503 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000135972 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000103225] [ENSMUST00000134274] [ENSMUST00000179332]
Predicted Effect probably benign
Transcript: ENSMUST00000103225
SMART Domains Protein: ENSMUSP00000099515
Gene: ENSMUSG00000057181

DomainStartEndE-ValueType
low complexity region 7 31 N/A INTRINSIC
Pfam:Njmu-R1 38 390 1.5e-204 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000134274
SMART Domains Protein: ENSMUSP00000120606
Gene: ENSMUSG00000057181

DomainStartEndE-ValueType
low complexity region 26 58 N/A INTRINSIC
Pfam:Njmu-R1 62 214 1.6e-84 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000179332
SMART Domains Protein: ENSMUSP00000135972
Gene: ENSMUSG00000057181

DomainStartEndE-ValueType
low complexity region 7 31 N/A INTRINSIC
Pfam:Njmu-R1 38 391 5.9e-231 PFAM
Meta Mutation Damage Score 0.1172 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.6%
Validation Efficiency 100% (39/39)
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcf1 A G 17: 35,959,915 I510T possibly damaging Het
Adamts18 T A 8: 113,737,580 K749* probably null Het
Alms1 A G 6: 85,587,803 E53G unknown Het
Bmper A G 9: 23,399,629 H453R probably benign Het
Btg1 T A 10: 96,618,354 M1K probably null Het
Cntfr A G 4: 41,658,900 I277T probably damaging Het
Col6a4 C A 9: 106,026,466 R1642I probably damaging Het
Ctnna3 T C 10: 65,002,568 I808T probably damaging Het
Cyp1a1 T A 9: 57,700,149 V20D probably benign Het
Dnah17 T C 11: 118,070,538 T2554A probably benign Het
Fcgbp A T 7: 28,104,116 Q1715L probably benign Het
Gabarapl1 T C 6: 129,538,630 F77S probably damaging Het
Gm1966 G T 7: 106,604,009 D9E possibly damaging Het
Hpse2 T C 19: 43,294,275 K180E probably damaging Het
Hs3st2 T A 7: 121,500,702 L257Q probably damaging Het
Ighv1-18 T C 12: 114,682,667 T106A probably benign Het
Ints2 A C 11: 86,242,952 L424R probably damaging Het
Iqgap2 A G 13: 95,750,033 V114A probably damaging Het
Kalrn A T 16: 34,314,209 I401N probably damaging Het
Maats1 A G 16: 38,298,214 V741A probably benign Het
Mast2 T A 4: 116,337,501 probably benign Het
Myo18a A G 11: 77,812,013 E5G possibly damaging Het
Nav3 A T 10: 109,880,533 probably null Het
Net1 G A 13: 3,884,949 T359I probably damaging Het
Pcsk9 T A 4: 106,444,702 H616L probably benign Het
Plekha5 G T 6: 140,589,232 V597L possibly damaging Het
Plekhg3 T A 12: 76,565,247 I374N probably damaging Het
Pros1 A T 16: 62,900,645 R188* probably null Het
Rhbg C T 3: 88,243,448 V434I probably damaging Het
Rims1 A G 1: 22,292,939 probably benign Het
Rxfp2 T C 5: 150,051,633 probably null Het
Sbf2 T C 7: 110,441,466 I385V probably damaging Het
Slc22a23 A C 13: 34,299,004 Y181* probably null Het
Spata31 T A 13: 64,921,655 V539E probably benign Het
Trpv5 G A 6: 41,659,705 R436C probably damaging Het
Vmn1r13 G A 6: 57,209,985 C43Y probably benign Het
Wif1 G A 10: 121,082,194 V156I probably benign Het
Zfyve16 T C 13: 92,504,549 N1229S probably damaging Het
Other mutations in 5730455P16Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00516:5730455P16Rik APN 11 80376812 missense possibly damaging 0.90
IGL03096:5730455P16Rik APN 11 80374179 missense probably damaging 1.00
PIT4431001:5730455P16Rik UTSW 11 80363924 missense probably damaging 1.00
R0383:5730455P16Rik UTSW 11 80363941 nonsense probably null
R0635:5730455P16Rik UTSW 11 80374065 splice site probably benign
R1376:5730455P16Rik UTSW 11 80363909 missense possibly damaging 0.90
R1376:5730455P16Rik UTSW 11 80363909 missense possibly damaging 0.90
R1598:5730455P16Rik UTSW 11 80364012 nonsense probably null
R1953:5730455P16Rik UTSW 11 80377946 missense probably damaging 1.00
R3236:5730455P16Rik UTSW 11 80368170 missense probably damaging 1.00
R4612:5730455P16Rik UTSW 11 80377980 start codon destroyed probably null 0.90
R4777:5730455P16Rik UTSW 11 80374215 missense probably damaging 1.00
R4820:5730455P16Rik UTSW 11 80375520 missense possibly damaging 0.63
R4847:5730455P16Rik UTSW 11 80374114 missense probably damaging 1.00
R5489:5730455P16Rik UTSW 11 80377952 start codon destroyed probably null
R7125:5730455P16Rik UTSW 11 80364925 missense probably damaging 0.97
Predicted Primers PCR Primer
(F):5'- ATCAAGGCTACCTCTCCAGC -3'
(R):5'- GAGTGTATCCCTGGTAAGAAATGTG -3'

Sequencing Primer
(F):5'- CTAGGGGGCCAGAATCTCAATC -3'
(R):5'- CCCTGGTAAGAAATGTGTGTTTCTC -3'
Posted On2015-04-30