Incidental Mutation 'R0491:Utp20'
ID42482
Institutional Source Beutler Lab
Gene Symbol Utp20
Ensembl Gene ENSMUSG00000004356
Gene NameUTP20 small subunit processome component
Synonyms3830408P06Rik, DRIM, mDRIM
MMRRC Submission 038689-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.979) question?
Stock #R0491 (G1)
Quality Score139
Status Validated
Chromosome10
Chromosomal Location88746607-88826804 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 88760912 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Leucine at position 2115 (F2115L)
Ref Sequence ENSEMBL: ENSMUSP00000004470 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000004470] [ENSMUST00000218967] [ENSMUST00000220188]
Predicted Effect probably damaging
Transcript: ENSMUST00000004470
AA Change: F2115L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000004470
Gene: ENSMUSG00000004356
AA Change: F2115L

DomainStartEndE-ValueType
low complexity region 244 255 N/A INTRINSIC
low complexity region 442 454 N/A INTRINSIC
low complexity region 571 581 N/A INTRINSIC
low complexity region 695 704 N/A INTRINSIC
Pfam:DRIM 910 1534 2.6e-176 PFAM
low complexity region 1585 1598 N/A INTRINSIC
low complexity region 1705 1719 N/A INTRINSIC
low complexity region 2503 2513 N/A INTRINSIC
low complexity region 2589 2605 N/A INTRINSIC
low complexity region 2727 2737 N/A INTRINSIC
low complexity region 2746 2764 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000218967
Predicted Effect possibly damaging
Transcript: ENSMUST00000220188
AA Change: F187L

PolyPhen 2 Score 0.873 (Sensitivity: 0.83; Specificity: 0.93)
Meta Mutation Damage Score 0.276 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 94.4%
Validation Efficiency 100% (65/65)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] UTP20 is a component of the U3 small nucleolar RNA (snoRNA) (SNORD3A; MIM 180710) protein complex (U3 snoRNP) and is involved in 18S rRNA processing (Wang et al., 2007 [PubMed 17498821]).[supplied by OMIM, Jun 2009]
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410089E03Rik T A 15: 8,182,243 S356T probably damaging Het
Abca13 T C 11: 9,298,235 F2661L probably benign Het
Acadsb A G 7: 131,430,107 D224G probably benign Het
Acsm1 A G 7: 119,640,697 H288R probably damaging Het
Adamts2 A G 11: 50,776,630 D465G probably damaging Het
Akap9 A T 5: 3,972,851 probably benign Het
Alms1 A G 6: 85,702,600 T3240A probably damaging Het
Ap3d1 A G 10: 80,719,241 W417R probably damaging Het
Arfgef1 C A 1: 10,179,987 probably benign Het
Atf6 A G 1: 170,787,344 probably null Het
Cacna1s T A 1: 136,089,008 probably benign Het
Clcn1 T C 6: 42,310,581 F740L probably benign Het
Clec12a T A 6: 129,364,053 D265E probably benign Het
Clic3 T A 2: 25,457,785 probably benign Het
Cntnap3 T G 13: 64,762,045 T749P probably benign Het
Col11a2 T A 17: 34,042,212 D45E probably null Het
Crxos T A 7: 15,898,535 S89T probably benign Het
Cxcr1 G T 1: 74,192,309 P185T possibly damaging Het
Cyp20a1 T A 1: 60,371,327 N262K possibly damaging Het
Dpy19l2 T C 9: 24,696,028 R46G probably benign Het
Dpysl2 A T 14: 66,807,962 L454Q probably damaging Het
Dvl3 C T 16: 20,527,423 probably benign Het
Eppin T A 2: 164,589,412 E98V possibly damaging Het
Fancm A T 12: 65,106,061 H1097L probably benign Het
Fkbp4 A G 6: 128,435,742 I75T probably damaging Het
Fmn2 A G 1: 174,581,959 H586R unknown Het
Gm973 C T 1: 59,558,234 probably benign Het
Haus6 A C 4: 86,602,846 V185G possibly damaging Het
Herc2 T A 7: 56,122,366 C1098S possibly damaging Het
Hic1 C A 11: 75,166,310 L584F possibly damaging Het
Itgb1bp1 C A 12: 21,276,895 probably benign Het
Kbtbd2 G A 6: 56,780,389 R121* probably null Het
Lgr4 C T 2: 110,007,281 probably benign Het
Lrrc55 T C 2: 85,191,920 E309G probably damaging Het
Mertk T C 2: 128,793,107 probably null Het
Micu3 A G 8: 40,366,253 probably benign Het
Mmp11 G A 10: 75,926,758 A287V probably benign Het
Mpzl2 A G 9: 45,042,741 Y47C probably damaging Het
Muc5b A C 7: 141,862,015 R2899S probably benign Het
Myo1b A G 1: 51,755,698 Y1078H probably benign Het
Naip1 A T 13: 100,423,219 D1092E probably benign Het
Ncapd3 T G 9: 27,057,883 V611G probably damaging Het
Ntpcr C T 8: 125,737,354 R73* probably null Het
Olfr1225 A T 2: 89,170,360 V284E probably benign Het
Olfr1475 G A 19: 13,479,493 A235V probably damaging Het
Osbp2 A G 11: 3,714,709 F88S probably damaging Het
Pkn3 A T 2: 30,089,877 T711S probably damaging Het
Plekhm1 T C 11: 103,394,776 K278E probably benign Het
Ppp1r36 A G 12: 76,439,291 T408A probably benign Het
Prss41 T C 17: 23,842,503 T105A possibly damaging Het
Psme1 G T 14: 55,579,921 probably benign Het
Ptprq A T 10: 107,608,175 Y1523N probably damaging Het
Ric8b A G 10: 84,992,222 D470G probably damaging Het
Scarb1 A G 5: 125,298,731 probably benign Het
Slc25a54 G A 3: 109,102,796 A204T probably damaging Het
Spink10 T C 18: 62,659,965 C67R probably damaging Het
St5 T A 7: 109,557,204 Q113L probably benign Het
Tmtc1 A T 6: 148,412,640 probably null Het
Tprkb A G 6: 85,924,464 D28G probably benign Het
Ttll13 A G 7: 80,260,350 H747R probably benign Het
Usp24 A G 4: 106,402,105 S1608G probably benign Het
Vmn1r200 A T 13: 22,395,191 I46L probably benign Het
Zdhhc8 A T 16: 18,228,390 M103K probably damaging Het
Zfp595 C T 13: 67,317,305 G298E probably damaging Het
Zfp738 T G 13: 67,670,021 H617P possibly damaging Het
Zfp9 A T 6: 118,465,202 H166Q probably damaging Het
Zp3r C A 1: 130,618,334 D80Y probably damaging Het
Other mutations in Utp20
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00530:Utp20 APN 10 88825444 missense possibly damaging 0.90
IGL00858:Utp20 APN 10 88809125 missense possibly damaging 0.69
IGL00858:Utp20 APN 10 88809138 missense probably benign
IGL00946:Utp20 APN 10 88748315 missense possibly damaging 0.82
IGL01061:Utp20 APN 10 88770704 missense probably benign 0.13
IGL01399:Utp20 APN 10 88758302 critical splice donor site probably null
IGL01548:Utp20 APN 10 88764781 missense probably damaging 1.00
IGL01587:Utp20 APN 10 88787535 missense probably damaging 0.98
IGL01789:Utp20 APN 10 88798279 critical splice donor site probably null
IGL01819:Utp20 APN 10 88792687 missense probably damaging 1.00
IGL02070:Utp20 APN 10 88821877 splice site probably benign
IGL02231:Utp20 APN 10 88791168 missense probably damaging 1.00
IGL02244:Utp20 APN 10 88815956 splice site probably benign
IGL02367:Utp20 APN 10 88771853 unclassified probably benign
IGL02553:Utp20 APN 10 88764795 missense probably damaging 0.99
IGL02748:Utp20 APN 10 88817295 missense probably benign 0.00
IGL02831:Utp20 APN 10 88815908 missense probably benign
IGL02986:Utp20 APN 10 88775285 missense probably damaging 1.00
IGL02997:Utp20 APN 10 88814034 missense probably benign
IGL03105:Utp20 APN 10 88791096 missense probably benign 0.10
IGL03251:Utp20 APN 10 88817326 critical splice acceptor site probably null
IGL03337:Utp20 APN 10 88754566 missense probably benign
IGL03348:Utp20 APN 10 88758317 missense probably benign 0.09
IGL03381:Utp20 APN 10 88822005 missense probably damaging 0.99
R0037:Utp20 UTSW 10 88798404 missense probably benign 0.05
R0107:Utp20 UTSW 10 88778391 missense probably benign 0.03
R0197:Utp20 UTSW 10 88777516 missense probably benign 0.22
R0219:Utp20 UTSW 10 88764675 missense probably damaging 1.00
R0315:Utp20 UTSW 10 88807421 missense probably damaging 1.00
R0328:Utp20 UTSW 10 88767107 missense possibly damaging 0.82
R0329:Utp20 UTSW 10 88817979 missense probably benign 0.00
R0330:Utp20 UTSW 10 88817979 missense probably benign 0.00
R0395:Utp20 UTSW 10 88818595 missense probably damaging 1.00
R0399:Utp20 UTSW 10 88820979 missense probably damaging 1.00
R0454:Utp20 UTSW 10 88822069 missense probably benign 0.00
R0456:Utp20 UTSW 10 88754573 missense possibly damaging 0.92
R0557:Utp20 UTSW 10 88748311 missense probably damaging 0.99
R0600:Utp20 UTSW 10 88767461 missense probably damaging 1.00
R0616:Utp20 UTSW 10 88770751 missense probably benign 0.14
R1076:Utp20 UTSW 10 88772459 missense probably benign 0.36
R1076:Utp20 UTSW 10 88772543 missense possibly damaging 0.86
R1330:Utp20 UTSW 10 88801189 missense probably damaging 0.96
R1440:Utp20 UTSW 10 88819339 missense probably benign 0.19
R1529:Utp20 UTSW 10 88753006 missense probably damaging 1.00
R1554:Utp20 UTSW 10 88764737 nonsense probably null
R1621:Utp20 UTSW 10 88762871 missense probably benign
R1641:Utp20 UTSW 10 88757972 missense possibly damaging 0.82
R1709:Utp20 UTSW 10 88749297 missense probably benign 0.29
R1734:Utp20 UTSW 10 88767461 missense probably damaging 1.00
R1755:Utp20 UTSW 10 88809769 missense probably benign 0.01
R1775:Utp20 UTSW 10 88770808 missense probably benign
R1866:Utp20 UTSW 10 88762770 nonsense probably null
R1867:Utp20 UTSW 10 88749443 missense probably benign
R1901:Utp20 UTSW 10 88753026 missense probably benign 0.02
R1902:Utp20 UTSW 10 88753026 missense probably benign 0.02
R1967:Utp20 UTSW 10 88816979 missense probably benign 0.03
R2060:Utp20 UTSW 10 88774795 missense probably damaging 0.98
R2102:Utp20 UTSW 10 88772917 missense probably damaging 0.99
R2110:Utp20 UTSW 10 88767451 critical splice donor site probably null
R2115:Utp20 UTSW 10 88786003 missense probably benign 0.02
R2128:Utp20 UTSW 10 88814055 missense probably damaging 0.99
R2129:Utp20 UTSW 10 88814055 missense probably damaging 0.99
R2180:Utp20 UTSW 10 88820939 missense probably damaging 0.98
R2280:Utp20 UTSW 10 88825503 splice site probably null
R2435:Utp20 UTSW 10 88820891 missense possibly damaging 0.89
R2914:Utp20 UTSW 10 88754475 critical splice donor site probably null
R3005:Utp20 UTSW 10 88777455 missense probably damaging 0.97
R3546:Utp20 UTSW 10 88782689 missense probably damaging 1.00
R3547:Utp20 UTSW 10 88782689 missense probably damaging 1.00
R3622:Utp20 UTSW 10 88757993 unclassified probably benign
R3737:Utp20 UTSW 10 88762806 missense probably benign 0.00
R3738:Utp20 UTSW 10 88762806 missense probably benign 0.00
R3841:Utp20 UTSW 10 88775203 unclassified probably benign
R4034:Utp20 UTSW 10 88762806 missense probably benign 0.00
R4035:Utp20 UTSW 10 88762806 missense probably benign 0.00
R4157:Utp20 UTSW 10 88761867 missense probably benign
R4243:Utp20 UTSW 10 88807325 critical splice donor site probably null
R4295:Utp20 UTSW 10 88754519 missense possibly damaging 0.54
R4632:Utp20 UTSW 10 88778261 missense probably damaging 1.00
R4633:Utp20 UTSW 10 88752952 missense probably benign
R4684:Utp20 UTSW 10 88807445 nonsense probably null
R4731:Utp20 UTSW 10 88754520 missense possibly damaging 0.93
R4735:Utp20 UTSW 10 88816918 missense possibly damaging 0.91
R4772:Utp20 UTSW 10 88809935 missense probably benign 0.09
R4912:Utp20 UTSW 10 88771960 missense probably benign 0.01
R4974:Utp20 UTSW 10 88816949 missense probably benign 0.08
R4991:Utp20 UTSW 10 88746934 missense probably benign 0.09
R5004:Utp20 UTSW 10 88748273 missense probably damaging 0.98
R5037:Utp20 UTSW 10 88775330 missense probably benign 0.00
R5043:Utp20 UTSW 10 88798746 missense possibly damaging 0.70
R5108:Utp20 UTSW 10 88768873 missense probably benign 0.00
R5138:Utp20 UTSW 10 88747377 missense probably damaging 0.96
R5252:Utp20 UTSW 10 88750670 missense probably benign 0.01
R5394:Utp20 UTSW 10 88772915 nonsense probably null
R5470:Utp20 UTSW 10 88817896 missense probably benign 0.14
R5558:Utp20 UTSW 10 88751467 missense probably damaging 1.00
R5678:Utp20 UTSW 10 88809117 missense probably benign 0.00
R5822:Utp20 UTSW 10 88817285 missense probably benign 0.00
R5866:Utp20 UTSW 10 88772559 missense possibly damaging 0.82
R5924:Utp20 UTSW 10 88815922 missense probably benign 0.00
R6026:Utp20 UTSW 10 88768679 missense probably benign 0.04
R6363:Utp20 UTSW 10 88757080 missense probably damaging 1.00
R6434:Utp20 UTSW 10 88772533 nonsense probably null
R6477:Utp20 UTSW 10 88768918 missense probably benign 0.05
R6480:Utp20 UTSW 10 88755186 critical splice donor site probably null
R6989:Utp20 UTSW 10 88778240 missense probably benign 0.00
R7033:Utp20 UTSW 10 88754475 critical splice donor site probably null
R7192:Utp20 UTSW 10 88772459 missense probably benign 0.09
R7236:Utp20 UTSW 10 88749342 missense probably benign 0.28
R7260:Utp20 UTSW 10 88751472 missense probably benign 0.39
R7317:Utp20 UTSW 10 88762935 missense possibly damaging 0.83
R7318:Utp20 UTSW 10 88813949 missense possibly damaging 0.89
Predicted Primers PCR Primer
(F):5'- TTTGGGGCTATCCACACAAACAGG -3'
(R):5'- GCTGCAAACTCCTACTGTACCATCC -3'

Sequencing Primer
(F):5'- GCTAAGCCTTCTTCCTACAGG -3'
(R):5'- CACAGGCATGGCTTTCTGAG -3'
Posted On2013-05-23