Incidental Mutation 'R0549:Tnik'
ID45010
Institutional Source Beutler Lab
Gene Symbol Tnik
Ensembl Gene ENSMUSG00000027692
Gene NameTRAF2 and NCK interacting kinase
SynonymsC630040K21Rik, 1500031A17Rik, 4831440I19Rik, C530008O15Rik
MMRRC Submission 038741-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0549 (G1)
Quality Score114
Status Validated
Chromosome3
Chromosomal Location28263214-28675858 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 28570920 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 335 (S335P)
Ref Sequence ENSEMBL: ENSMUSP00000124726 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000159236] [ENSMUST00000159308] [ENSMUST00000159680] [ENSMUST00000160307] [ENSMUST00000160518] [ENSMUST00000160934] [ENSMUST00000161964] [ENSMUST00000162485] [ENSMUST00000162777]
Predicted Effect possibly damaging
Transcript: ENSMUST00000159236
AA Change: S335P

PolyPhen 2 Score 0.734 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000124681
Gene: ENSMUSG00000027692
AA Change: S335P

DomainStartEndE-ValueType
S_TKc 25 289 1.23e-96 SMART
low complexity region 317 340 N/A INTRINSIC
coiled coil region 360 482 N/A INTRINSIC
low complexity region 691 726 N/A INTRINSIC
low complexity region 793 812 N/A INTRINSIC
low complexity region 951 958 N/A INTRINSIC
CNH 1005 1303 1.92e-117 SMART
Predicted Effect unknown
Transcript: ENSMUST00000159308
AA Change: S335P
SMART Domains Protein: ENSMUSP00000125466
Gene: ENSMUSG00000027692
AA Change: S335P

DomainStartEndE-ValueType
S_TKc 25 289 1.23e-96 SMART
low complexity region 317 340 N/A INTRINSIC
coiled coil region 360 482 N/A INTRINSIC
low complexity region 636 671 N/A INTRINSIC
low complexity region 746 765 N/A INTRINSIC
low complexity region 904 911 N/A INTRINSIC
CNH 958 1256 1.92e-117 SMART
Predicted Effect unknown
Transcript: ENSMUST00000159680
AA Change: S335P
SMART Domains Protein: ENSMUSP00000124876
Gene: ENSMUSG00000027692
AA Change: S335P

DomainStartEndE-ValueType
S_TKc 25 289 1.23e-96 SMART
low complexity region 317 340 N/A INTRINSIC
coiled coil region 360 511 N/A INTRINSIC
low complexity region 720 755 N/A INTRINSIC
low complexity region 822 841 N/A INTRINSIC
low complexity region 980 987 N/A INTRINSIC
CNH 1034 1332 1.92e-117 SMART
Predicted Effect unknown
Transcript: ENSMUST00000160307
AA Change: S335P
SMART Domains Protein: ENSMUSP00000125081
Gene: ENSMUSG00000027692
AA Change: S335P

DomainStartEndE-ValueType
S_TKc 25 289 1.23e-96 SMART
low complexity region 317 340 N/A INTRINSIC
coiled coil region 360 511 N/A INTRINSIC
low complexity region 720 755 N/A INTRINSIC
low complexity region 830 849 N/A INTRINSIC
low complexity region 988 995 N/A INTRINSIC
CNH 1042 1340 1.92e-117 SMART
Predicted Effect unknown
Transcript: ENSMUST00000160518
AA Change: S335P
SMART Domains Protein: ENSMUSP00000124011
Gene: ENSMUSG00000027692
AA Change: S335P

DomainStartEndE-ValueType
S_TKc 25 289 5.9e-99 SMART
low complexity region 317 340 N/A INTRINSIC
coiled coil region 360 482 N/A INTRINSIC
low complexity region 691 726 N/A INTRINSIC
low complexity region 801 820 N/A INTRINSIC
low complexity region 959 966 N/A INTRINSIC
CNH 1013 1311 9.3e-120 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000160934
SMART Domains Protein: ENSMUSP00000123859
Gene: ENSMUSG00000027692

DomainStartEndE-ValueType
Pfam:Pkinase_Tyr 25 212 2.2e-37 PFAM
Pfam:Pkinase 25 219 5.9e-52 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000161423
Predicted Effect probably benign
Transcript: ENSMUST00000161964
AA Change: S335P

PolyPhen 2 Score 0.043 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000125411
Gene: ENSMUSG00000027692
AA Change: S335P

DomainStartEndE-ValueType
S_TKc 25 289 1.23e-96 SMART
low complexity region 317 340 N/A INTRINSIC
coiled coil region 360 482 N/A INTRINSIC
low complexity region 636 671 N/A INTRINSIC
low complexity region 738 757 N/A INTRINSIC
low complexity region 896 903 N/A INTRINSIC
CNH 950 1248 1.92e-117 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000162037
Predicted Effect unknown
Transcript: ENSMUST00000162485
AA Change: S335P
SMART Domains Protein: ENSMUSP00000124387
Gene: ENSMUSG00000027692
AA Change: S335P

DomainStartEndE-ValueType
S_TKc 25 289 1.23e-96 SMART
low complexity region 317 340 N/A INTRINSIC
coiled coil region 360 511 N/A INTRINSIC
low complexity region 665 700 N/A INTRINSIC
low complexity region 775 794 N/A INTRINSIC
low complexity region 933 940 N/A INTRINSIC
CNH 987 1285 1.92e-117 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000162777
AA Change: S335P

PolyPhen 2 Score 0.874 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000124726
Gene: ENSMUSG00000027692
AA Change: S335P

DomainStartEndE-ValueType
S_TKc 25 289 1.23e-96 SMART
low complexity region 317 340 N/A INTRINSIC
coiled coil region 360 511 N/A INTRINSIC
low complexity region 665 700 N/A INTRINSIC
low complexity region 767 786 N/A INTRINSIC
low complexity region 925 932 N/A INTRINSIC
CNH 979 1277 1.92e-117 SMART
Meta Mutation Damage Score 0.182 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 96.9%
  • 20x: 94.3%
Validation Efficiency 96% (48/50)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Germinal center kinases (GCKs), such as TNIK, are characterized by an N-terminal kinase domain and a C-terminal GCK domain that serves a regulatory function (Fu et al., 1999 [PubMed 10521462]).[supplied by OMIM, Mar 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit impaired postsynaptic signaling and cognitive function. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc10 A G 17: 46,322,290 F498L probably damaging Het
Adamts6 A T 13: 104,297,255 D64V possibly damaging Het
Agbl2 T C 2: 90,789,843 probably benign Het
Angptl3 A G 4: 99,031,455 S151G probably benign Het
Arhgap39 C T 15: 76,734,886 D833N probably damaging Het
C4b G T 17: 34,735,415 L927I probably damaging Het
Ccl3 T C 11: 83,648,336 T66A probably damaging Het
Cdh7 T C 1: 110,108,944 L618P probably damaging Het
Cfap65 T C 1: 74,918,444 T989A probably benign Het
Cnpy4 T C 5: 138,187,637 F18S possibly damaging Het
Col6a5 A G 9: 105,904,579 probably benign Het
Dppa2 G A 16: 48,318,671 R289H probably benign Het
Evx2 T C 2: 74,659,134 T96A probably benign Het
Frmd4a A G 2: 4,603,967 E577G possibly damaging Het
Gcgr G A 11: 120,536,561 G166S probably benign Het
Gm4788 A T 1: 139,739,488 D377E probably damaging Het
Gm5316 T C 6: 122,900,191 noncoding transcript Het
Gria1 G A 11: 57,228,973 R292Q probably damaging Het
Hars2 T A 18: 36,786,208 probably null Het
Hkdc1 T A 10: 62,400,240 T508S probably benign Het
Kif2b A T 11: 91,576,584 I291N probably damaging Het
Lmbrd1 A T 1: 24,744,920 T377S probably benign Het
Lrrc28 A G 7: 67,628,342 probably benign Het
Mmp3 A T 9: 7,455,638 N463I probably benign Het
Myh6 A G 14: 54,958,608 F578S probably damaging Het
Ncbp1 T A 4: 46,168,476 M608K possibly damaging Het
Nf1 T C 11: 79,468,771 F1412L probably damaging Het
Nlrp5 T A 7: 23,441,802 W1083R probably damaging Het
Nrsn1 T C 13: 25,262,258 Y45C probably benign Het
Olfr401 T G 11: 74,121,475 M62R probably damaging Het
Osbpl7 G T 11: 97,067,542 R881L probably damaging Het
Papss1 A G 3: 131,619,213 E456G possibly damaging Het
Pbxip1 T A 3: 89,443,592 probably benign Het
Pcca A G 14: 122,638,377 probably benign Het
Pde1a T A 2: 79,865,070 N511I probably damaging Het
Prpf39 A T 12: 65,056,256 I435F probably benign Het
Rnf213 C T 11: 119,465,082 T4117M probably damaging Het
Sel1l2 A T 2: 140,265,882 M216K probably damaging Het
Sidt2 A G 9: 45,953,119 probably null Het
Sirt3 A T 7: 140,869,487 probably null Het
Smpd4 T C 16: 17,639,312 V378A probably benign Het
Svil T A 18: 5,064,566 S642T possibly damaging Het
Tcp10a A G 17: 7,326,551 K92E probably benign Het
Tmem144 T C 3: 79,822,744 D233G probably damaging Het
Tnfrsf21 C T 17: 43,038,213 H239Y probably benign Het
Ush2a T C 1: 188,946,953 L4786P probably damaging Het
Utp11 A T 4: 124,686,079 probably benign Het
Vmn1r67 A G 7: 10,447,714 N241D probably damaging Het
Vmn2r11 A T 5: 109,052,097 C497S possibly damaging Het
Other mutations in Tnik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00516:Tnik APN 3 28654218 missense probably damaging 1.00
IGL00726:Tnik APN 3 28532898 missense probably damaging 1.00
IGL01022:Tnik APN 3 28625228 splice site probably null
IGL01145:Tnik APN 3 28604167 intron probably benign
IGL01664:Tnik APN 3 28638479 missense probably damaging 1.00
IGL01843:Tnik APN 3 28570858 splice site probably null
IGL02378:Tnik APN 3 28638459 nonsense probably null
IGL02448:Tnik APN 3 28621077 missense probably null 0.01
IGL02756:Tnik APN 3 28542030 missense probably damaging 1.00
IGL03332:Tnik APN 3 28666155 missense probably damaging 1.00
Usher UTSW 3 28564097 missense possibly damaging 0.61
R0135:Tnik UTSW 3 28607245 missense possibly damaging 0.67
R0418:Tnik UTSW 3 28570880 nonsense probably null
R0540:Tnik UTSW 3 28650159 missense probably damaging 1.00
R0556:Tnik UTSW 3 28625218 missense possibly damaging 0.95
R0586:Tnik UTSW 3 28577361 splice site probably benign
R0607:Tnik UTSW 3 28650159 missense probably damaging 1.00
R0842:Tnik UTSW 3 28594086 missense possibly damaging 0.72
R1068:Tnik UTSW 3 28532975 missense probably damaging 1.00
R1171:Tnik UTSW 3 28532940 missense probably damaging 1.00
R1597:Tnik UTSW 3 28604269 missense probably damaging 1.00
R1638:Tnik UTSW 3 28665740 missense probably damaging 0.99
R1652:Tnik UTSW 3 28604293 missense probably benign 0.22
R1996:Tnik UTSW 3 28665680 missense probably damaging 1.00
R2333:Tnik UTSW 3 28532996 missense probably damaging 1.00
R2426:Tnik UTSW 3 28646681 missense probably damaging 1.00
R2509:Tnik UTSW 3 28667915 missense probably damaging 1.00
R3774:Tnik UTSW 3 28638419 missense probably damaging 0.98
R3775:Tnik UTSW 3 28638419 missense probably damaging 0.98
R4007:Tnik UTSW 3 28604281 missense probably damaging 1.00
R4119:Tnik UTSW 3 28666175 missense probably damaging 1.00
R4209:Tnik UTSW 3 28359065 splice site probably benign
R4441:Tnik UTSW 3 28564097 missense possibly damaging 0.61
R4611:Tnik UTSW 3 28542100 critical splice donor site probably null
R4714:Tnik UTSW 3 28594077 missense possibly damaging 0.53
R4772:Tnik UTSW 3 28607210 missense probably benign 0.09
R4829:Tnik UTSW 3 28539541 intron probably benign
R4839:Tnik UTSW 3 28596075 missense possibly damaging 0.86
R4898:Tnik UTSW 3 28650086 missense probably damaging 1.00
R5029:Tnik UTSW 3 28665844 splice site probably null
R5278:Tnik UTSW 3 28650060 missense probably damaging 1.00
R5307:Tnik UTSW 3 28541972 missense probably damaging 1.00
R5330:Tnik UTSW 3 28542018 missense probably damaging 1.00
R5375:Tnik UTSW 3 28594092 missense probably benign 0.02
R5459:Tnik UTSW 3 28661741 missense probably damaging 1.00
R5708:Tnik UTSW 3 28611971 critical splice donor site probably null
R5749:Tnik UTSW 3 28594092 missense probably benign 0.02
R5751:Tnik UTSW 3 28594092 missense probably benign 0.02
R5780:Tnik UTSW 3 28594092 missense probably benign 0.02
R5837:Tnik UTSW 3 28668053 unclassified probably benign
R5969:Tnik UTSW 3 28620948 missense probably damaging 1.00
R6244:Tnik UTSW 3 28650179 missense probably damaging 1.00
R6273:Tnik UTSW 3 28577500 missense possibly damaging 0.94
R6457:Tnik UTSW 3 28539448 missense probably damaging 1.00
R6464:Tnik UTSW 3 28611970 critical splice donor site probably null
R6473:Tnik UTSW 3 28263643 start codon destroyed probably null 0.93
R6737:Tnik UTSW 3 28596086 missense possibly damaging 0.72
R7049:Tnik UTSW 3 28661704 nonsense probably null
R7237:Tnik UTSW 3 28638419 missense probably damaging 0.98
R7267:Tnik UTSW 3 28646627 missense probably damaging 0.99
X0022:Tnik UTSW 3 28667951 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCATGCACAGCTTCAGTGTCAGTAG -3'
(R):5'- GGGTCACGAATACAGGCCATACATC -3'

Sequencing Primer
(F):5'- agtcccttgtgttgtgctg -3'
(R):5'- GCCATACATCTTGGGGGAC -3'
Posted On2013-06-11