Incidental Mutation 'R6212:Map2k1'
ID503514
Institutional Source Beutler Lab
Gene Symbol Map2k1
Ensembl Gene ENSMUSG00000004936
Gene Namemitogen-activated protein kinase kinase 1
SynonymsMek1, MAP kinase kinase 1, Prkmk1
MMRRC Submission 044345-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6212 (G1)
Quality Score225.009
Status Validated
Chromosome9
Chromosomal Location64185770-64253631 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 64205163 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Glutamine at position 155 (L155Q)
Ref Sequence ENSEMBL: ENSMUSP00000005066 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000005066]
Predicted Effect probably damaging
Transcript: ENSMUST00000005066
AA Change: L155Q

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000005066
Gene: ENSMUSG00000004936
AA Change: L155Q

DomainStartEndE-ValueType
low complexity region 30 51 N/A INTRINSIC
S_TKc 68 361 4.44e-80 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.1%
  • 20x: 97.2%
Validation Efficiency 96% (52/54)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the dual specificity protein kinase family, which acts as a mitogen-activated protein (MAP) kinase kinase. MAP kinases, also known as extracellular signal-regulated kinases (ERKs), act as an integration point for multiple biochemical signals. This protein kinase lies upstream of MAP kinases and stimulates the enzymatic activity of MAP kinases upon wide variety of extra- and intracellular signals. As an essential component of MAP kinase signal transduction pathway, this kinase is involved in many cellular processes such as proliferation, differentiation, transcription regulation and development. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous inactivation of this gene leads to reduced embryo size and midgestational lethality due to impaired development and hypovascularization of the placenta with decreased labyrinth cell proliferation and enhanced cell apoptosis. Mutant MEFs fail to exhibit fibronectin-induced migration. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acsm2 T A 7: 119,573,282 I116N probably damaging Het
Ap3b1 T C 13: 94,451,073 S452P probably damaging Het
Ap3b1 C A 13: 94,493,699 H821N unknown Het
Apex1 C T 14: 50,926,893 P264S probably benign Het
Arhgap27 T C 11: 103,360,872 Y10C probably damaging Het
Bag6 A G 17: 35,140,302 T208A probably benign Het
Brd4 G T 17: 32,202,449 P771Q probably damaging Het
Capn3 A G 2: 120,477,186 S69G probably benign Het
Ccdc13 A G 9: 121,798,909 probably benign Het
Celsr1 T C 15: 85,916,687 H2519R probably benign Het
Chd8 T A 14: 52,201,698 N48I probably damaging Het
Cmip T C 8: 117,377,156 Y128H probably damaging Het
Dnhd1 C T 7: 105,704,048 P2803S probably damaging Het
Dusp26 G A 8: 31,094,224 D120N probably damaging Het
Epha6 T C 16: 60,425,356 H160R possibly damaging Het
Erg C T 16: 95,379,163 V215I probably damaging Het
Fam71f1 T C 6: 29,319,374 L59P probably damaging Het
Fbxo6 A T 4: 148,149,522 I39N probably damaging Het
Gabbr2 T C 4: 46,681,189 D124G probably damaging Het
Gapdh T C 6: 125,162,698 H203R probably damaging Het
Ggnbp2 T C 11: 84,836,677 M42V possibly damaging Het
Hk2 C A 6: 82,728,842 A827S probably benign Het
Hoxa5 T C 6: 52,202,714 E227G probably damaging Het
Itgax C A 7: 128,130,332 H31N possibly damaging Het
Itgax A G 7: 128,147,853 D942G probably benign Het
Kars A T 8: 112,000,197 probably null Het
Lama3 T C 18: 12,513,645 F1739L probably damaging Het
Mcf2l A T 8: 13,017,431 D1013V probably damaging Het
Mocs1 G A 17: 49,435,196 G118S probably damaging Het
Ncam2 T C 16: 81,432,762 S37P probably damaging Het
Nfxl1 A G 5: 72,516,210 probably null Het
Nodal C T 10: 61,423,521 H246Y possibly damaging Het
Nwd1 G A 8: 72,695,322 V999M possibly damaging Het
Oaz3 T A 3: 94,435,068 T139S probably benign Het
Olfr1347 T C 7: 6,488,368 probably null Het
Olfr58 A G 9: 19,783,289 D52G probably damaging Het
P3h3 T A 6: 124,845,643 T522S probably benign Het
Pgap1 A G 1: 54,514,893 F457S probably damaging Het
Prkce T C 17: 86,559,301 Y530H probably damaging Het
Ptpn3 A T 4: 57,270,070 C31S probably damaging Het
Rsf1 G GACGGCGGCA 7: 97,579,909 probably benign Het
Serpinb6e T A 13: 33,841,237 N24Y probably damaging Het
Slc4a8 T C 15: 100,811,571 V937A possibly damaging Het
Smgc T A 15: 91,850,627 probably benign Het
Srcap T A 7: 127,549,689 N2027K probably damaging Het
Stra6l T C 4: 45,884,664 Y565H probably benign Het
Tmem262 A G 19: 6,080,638 E62G possibly damaging Het
Tnrc6a T A 7: 123,143,742 probably null Het
Txlnb T C 10: 17,799,309 I70T probably damaging Het
Whrn A T 4: 63,494,686 L25* probably null Het
Zfp326 T A 5: 105,910,231 V412E probably damaging Het
Zfp831 A G 2: 174,645,868 R779G possibly damaging Het
Other mutations in Map2k1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02195:Map2k1 APN 9 64193808 missense probably benign 0.39
mystic_falls UTSW 9 64191266 critical splice donor site probably null
R0366:Map2k1 UTSW 9 64193702 splice site probably null
R4285:Map2k1 UTSW 9 64212643 missense probably damaging 0.99
R5254:Map2k1 UTSW 9 64187745 unclassified probably benign
R5261:Map2k1 UTSW 9 64191561 missense probably damaging 1.00
R5741:Map2k1 UTSW 9 64214601 missense possibly damaging 0.89
R5742:Map2k1 UTSW 9 64193771 missense probably damaging 0.99
R5865:Map2k1 UTSW 9 64191266 critical splice donor site probably null
R6299:Map2k1 UTSW 9 64214490 missense possibly damaging 0.52
R6460:Map2k1 UTSW 9 64187295 missense probably damaging 0.97
R6843:Map2k1 UTSW 9 64187691 missense probably damaging 0.99
R7028:Map2k1 UTSW 9 64193823 missense probably benign 0.36
R7115:Map2k1 UTSW 9 64212606 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TCTAACAAAGATACCTTGCCCTG -3'
(R):5'- AAGCCTGCCTGAGTTCTTTG -3'

Sequencing Primer
(F):5'- GTCATCCTATGGGAAATGCTCTAGC -3'
(R):5'- AGCCTGCCTGAGTTCTTTGATAGC -3'
Posted On2018-02-27