Incidental Mutation 'R1435:Pcsk5'
ID159491
Institutional Source Beutler Lab
Gene Symbol Pcsk5
Ensembl Gene ENSMUSG00000024713
Gene Nameproprotein convertase subtilisin/kexin type 5
SynonymsPC6, SPC6, b2b1549Clo, b2b585Clo, PC5A, PC5/6A
MMRRC Submission 039490-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1435 (G1)
Quality Score225
Status Not validated
Chromosome19
Chromosomal Location17432832-17837632 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) A to T at 17563882 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Stop codon at position 844 (C844*)
Ref Sequence ENSEMBL: ENSMUSP00000050272 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025618] [ENSMUST00000050715]
Predicted Effect probably null
Transcript: ENSMUST00000025618
AA Change: C844*
SMART Domains Protein: ENSMUSP00000025618
Gene: ENSMUSG00000024713
AA Change: C844*

DomainStartEndE-ValueType
low complexity region 17 29 N/A INTRINSIC
Pfam:S8_pro-domain 40 116 4.6e-27 PFAM
Pfam:Peptidase_S8 164 447 2.1e-46 PFAM
Pfam:P_proprotein 507 597 2.1e-33 PFAM
FU 632 682 4.92e-13 SMART
FU 685 732 4.84e-12 SMART
EGF_like 690 723 3.29e1 SMART
FU 736 779 1.29e-7 SMART
FU 781 826 5.74e-14 SMART
FU 834 881 2.23e-11 SMART
EGF_like 839 870 3.43e1 SMART
FU 884 929 1.84e-12 SMART
FU 931 981 1.47e-11 SMART
FU 984 1030 1e-4 SMART
EGF_like 989 1020 2.92e1 SMART
FU 1034 1079 5.04e-10 SMART
FU 1081 1123 3.08e-5 SMART
FU 1127 1168 4.88e-8 SMART
FU 1206 1248 2.7e-10 SMART
EGF_like 1211 1239 5.91e1 SMART
FU 1252 1299 1.48e-7 SMART
EGF 1264 1305 1.69e1 SMART
FU 1301 1345 2.31e-9 SMART
FU 1347 1390 8.98e-7 SMART
EGF_like 1352 1381 7.23e1 SMART
FU 1392 1438 1.04e-11 SMART
FU 1442 1487 6.8e-7 SMART
EGF 1447 1476 2.16e1 SMART
FU 1491 1536 3.37e-11 SMART
FU 1540 1585 9.32e-14 SMART
EGF_like 1545 1576 2.8e1 SMART
FU 1589 1636 1.39e-12 SMART
FU 1640 1685 6.49e-13 SMART
EGF_like 1645 1676 6.67e1 SMART
FU 1691 1738 7.01e-9 SMART
transmembrane domain 1770 1789 N/A INTRINSIC
low complexity region 1827 1840 N/A INTRINSIC
low complexity region 1858 1876 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000050715
AA Change: C844*
SMART Domains Protein: ENSMUSP00000050272
Gene: ENSMUSG00000024713
AA Change: C844*

DomainStartEndE-ValueType
low complexity region 17 29 N/A INTRINSIC
PDB:1KN6|A 35 116 6e-11 PDB
Pfam:Peptidase_S8 168 456 2.9e-59 PFAM
Pfam:P_proprotein 507 597 1.5e-34 PFAM
FU 632 682 4.92e-13 SMART
FU 685 732 4.84e-12 SMART
EGF_like 690 723 3.29e1 SMART
FU 736 779 1.29e-7 SMART
FU 781 826 5.74e-14 SMART
FU 834 884 1.4e-8 SMART
EGF_like 839 870 3.43e1 SMART
Coding Region Coverage
  • 1x: 98.7%
  • 3x: 97.5%
  • 10x: 93.0%
  • 20x: 81.3%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a subtilisin-like proprotein convertase that mediates posttranslational endoproteolytic processing of various proprotein substrates traversing the secretory pathway. The encoded protein is an inactive zymogen that undergoes autoproteolytic processing in the endoplasmic reticulum and the Golgi network to generate an active enzyme. Mice lacking the encoded protein die at an early embryonic stage. Conditional inactivation this gene in the epiblast but not in the extraembryonic tissue bypasses embryonic lethality but results in death at birth. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Jul 2015]
PHENOTYPE: Mice homozygous for a null mutation in this gene display embryonic lethality between E4.5-E7.5. Mice homozygous for ENU-induced mutations exhibit heterotaxia with congenital heart defects and immotile respiratory cilia. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2810474O19Rik A G 6: 149,326,082 T209A probably benign Het
Acadvl T G 11: 70,014,816 T62P probably benign Het
AF067061 T A 13: 120,263,988 W63R probably damaging Het
Amz1 A T 5: 140,748,166 N166Y probably damaging Het
Anxa6 T C 11: 54,991,410 Q518R probably benign Het
Aox3 G A 1: 58,163,446 probably null Het
Arid1a C T 4: 133,680,698 R2166Q unknown Het
Armc4 T A 18: 7,222,646 H541L probably benign Het
Asb4 T G 6: 5,398,410 I125S probably benign Het
Aspscr1 T C 11: 120,689,222 S196P probably benign Het
Atxn3 A G 12: 101,942,201 F131L probably benign Het
B3gnt5 T A 16: 19,769,174 Y48N probably damaging Het
Bglap3 A G 3: 88,369,146 M35T possibly damaging Het
Cabp1 A T 5: 115,173,208 D79E probably damaging Het
Chd2 C T 7: 73,453,136 R1367Q probably damaging Het
Clec5a T A 6: 40,584,424 Q29L probably damaging Het
Cmtr2 T C 8: 110,221,079 L7P probably benign Het
Cnbd1 T C 4: 18,907,026 I183V probably benign Het
Col7a1 G A 9: 108,963,273 G1297D unknown Het
Csnk1g3 G A 18: 53,906,674 probably null Het
Cyp4a32 A T 4: 115,606,666 N134I probably damaging Het
Cyp4f16 CTATG CTATGTATG 17: 32,550,734 probably null Het
Dst G A 1: 34,113,945 V56M probably damaging Het
Engase A T 11: 118,484,901 T32S probably damaging Het
Fam117b T C 1: 59,969,063 I352T possibly damaging Het
Golga4 C A 9: 118,535,440 D290E probably benign Het
Gtf2a1l C A 17: 88,694,315 H153N probably damaging Het
Hivep1 C A 13: 42,158,043 T1253N probably damaging Het
Hps1 T C 19: 42,762,275 S398G probably benign Het
Il1r2 T A 1: 40,105,299 F49I probably damaging Het
Iqsec1 A G 6: 90,672,024 S808P probably damaging Het
Lrrk1 A G 7: 66,273,028 L289P probably damaging Het
Magi2 T A 5: 20,358,945 D358E probably damaging Het
Man2b2 A G 5: 36,813,067 W832R probably damaging Het
Mfsd4a G T 1: 132,067,756 T46K probably damaging Het
N4bp3 G A 11: 51,644,340 R341W probably damaging Het
Olfr284 A T 15: 98,340,328 H220Q possibly damaging Het
Olfr568 T C 7: 102,877,767 S216P probably damaging Het
Otof A G 5: 30,378,695 L1353S probably benign Het
Pdk2 T C 11: 95,031,895 Y153C probably damaging Het
Pes1 T C 11: 3,976,075 V292A probably benign Het
Pex14 T C 4: 148,963,527 T198A probably benign Het
Phactr4 G A 4: 132,377,248 T256I probably benign Het
Pnpla2 G A 7: 141,457,411 R109H probably benign Het
Polh G A 17: 46,194,255 T145I probably damaging Het
Polr3d A T 14: 70,440,039 V299E probably benign Het
Polr3e C T 7: 120,940,788 T586M probably benign Het
Rbm20 T A 19: 53,814,157 F365L probably benign Het
Rnf213 G T 11: 119,436,005 C1606F probably damaging Het
Sipa1l2 A G 8: 125,468,725 V758A probably damaging Het
Slc22a16 T A 10: 40,587,607 M451K probably damaging Het
Slc28a1 T C 7: 81,153,517 S359P probably damaging Het
Slc45a1 G T 4: 150,644,048 F99L probably damaging Het
Sp3 A T 2: 72,938,156 N754K possibly damaging Het
Taf4b A T 18: 14,807,409 Q315L probably damaging Het
Tmem2 A T 19: 21,844,706 Q1155L probably benign Het
Tmprss15 A T 16: 79,021,454 N544K probably benign Het
Tnfsf13b A G 8: 10,035,358 I283V probably benign Het
Tnfsf14 T A 17: 57,190,605 E209V possibly damaging Het
Uckl1 T G 2: 181,573,133 S283R probably benign Het
Ush1g T C 11: 115,318,468 D300G probably damaging Het
Virma C T 4: 11,528,621 A1286V probably damaging Het
Vmn2r114 ATTT ATT 17: 23,290,932 probably null Het
Vmn2r59 A T 7: 42,046,205 M261K possibly damaging Het
Vwf A T 6: 125,642,249 K1297* probably null Het
Zdbf2 G A 1: 63,303,040 E193K possibly damaging Het
Zfp759 T G 13: 67,138,766 I127S possibly damaging Het
Other mutations in Pcsk5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00418:Pcsk5 APN 19 17511421 missense possibly damaging 0.49
IGL00423:Pcsk5 APN 19 17642559 missense probably benign 0.23
IGL01315:Pcsk5 APN 19 17451958 missense probably damaging 1.00
IGL01372:Pcsk5 APN 19 17617744 missense probably damaging 1.00
IGL01738:Pcsk5 APN 19 17433780 splice site probably benign
IGL01874:Pcsk5 APN 19 17595677 missense probably damaging 0.96
IGL02070:Pcsk5 APN 19 17439042 missense probably benign 0.25
IGL02311:Pcsk5 APN 19 17433420 nonsense probably null
IGL02436:Pcsk5 APN 19 17564708 critical splice donor site probably null
IGL02498:Pcsk5 APN 19 17511556 missense probably damaging 0.99
IGL02504:Pcsk5 APN 19 17477872 critical splice donor site probably null
IGL02664:Pcsk5 APN 19 17456770 missense probably damaging 1.00
IGL02735:Pcsk5 APN 19 17675468 missense probably damaging 1.00
IGL02941:Pcsk5 APN 19 17447501 missense probably damaging 1.00
PIT4377001:Pcsk5 UTSW 19 17439102 missense probably damaging 1.00
R0007:Pcsk5 UTSW 19 17654861 missense probably damaging 1.00
R0007:Pcsk5 UTSW 19 17654861 missense probably damaging 1.00
R0032:Pcsk5 UTSW 19 17564815 missense possibly damaging 0.81
R0032:Pcsk5 UTSW 19 17564815 missense possibly damaging 0.81
R0373:Pcsk5 UTSW 19 17654849 missense probably damaging 1.00
R0784:Pcsk5 UTSW 19 17714769 missense probably benign 0.06
R0843:Pcsk5 UTSW 19 17654818 missense probably damaging 1.00
R1014:Pcsk5 UTSW 19 17564830 missense probably damaging 1.00
R1221:Pcsk5 UTSW 19 17837148 missense possibly damaging 0.85
R1471:Pcsk5 UTSW 19 17568324 missense probably damaging 1.00
R1564:Pcsk5 UTSW 19 17654756 missense probably damaging 1.00
R1597:Pcsk5 UTSW 19 17436600 missense probably benign 0.00
R1614:Pcsk5 UTSW 19 17515256 missense probably damaging 1.00
R1661:Pcsk5 UTSW 19 17447574 missense probably damaging 0.98
R1671:Pcsk5 UTSW 19 17454868 missense probably damaging 1.00
R1703:Pcsk5 UTSW 19 17752094 missense probably benign 0.15
R1793:Pcsk5 UTSW 19 17454750 missense possibly damaging 0.83
R1855:Pcsk5 UTSW 19 17515192 missense possibly damaging 0.93
R1909:Pcsk5 UTSW 19 17433461 missense probably benign 0.00
R1959:Pcsk5 UTSW 19 17433418 missense unknown
R2006:Pcsk5 UTSW 19 17477916 missense probably benign 0.32
R2045:Pcsk5 UTSW 19 17581144 missense possibly damaging 0.48
R2061:Pcsk5 UTSW 19 17454872 missense probably benign 0.03
R2110:Pcsk5 UTSW 19 17473059 missense probably damaging 1.00
R2402:Pcsk5 UTSW 19 17474834 nonsense probably null
R2496:Pcsk5 UTSW 19 17466158 nonsense probably null
R4115:Pcsk5 UTSW 19 17433419 missense unknown
R4504:Pcsk5 UTSW 19 17451955 missense probably damaging 1.00
R4616:Pcsk5 UTSW 19 17560750 missense probably benign 0.00
R4683:Pcsk5 UTSW 19 17473041 missense probably damaging 1.00
R4717:Pcsk5 UTSW 19 17525267 missense probably damaging 1.00
R4761:Pcsk5 UTSW 19 17837148 missense possibly damaging 0.85
R4789:Pcsk5 UTSW 19 17433599 missense probably benign 0.09
R4880:Pcsk5 UTSW 19 17447690 missense probably damaging 1.00
R5100:Pcsk5 UTSW 19 17515135 critical splice donor site probably null
R5114:Pcsk5 UTSW 19 17675585 missense probably damaging 1.00
R5116:Pcsk5 UTSW 19 17463434 missense possibly damaging 0.87
R5193:Pcsk5 UTSW 19 17564810 missense possibly damaging 0.79
R5279:Pcsk5 UTSW 19 17595658 splice site probably null
R5334:Pcsk5 UTSW 19 17461851 missense probably benign 0.00
R5369:Pcsk5 UTSW 19 17581255 missense probably damaging 1.00
R5451:Pcsk5 UTSW 19 17463356 missense possibly damaging 0.91
R5547:Pcsk5 UTSW 19 17752124 missense probably benign 0.08
R5630:Pcsk5 UTSW 19 17575831 missense probably benign 0.04
R5805:Pcsk5 UTSW 19 17456829 missense probably benign 0.01
R6063:Pcsk5 UTSW 19 17454681 critical splice donor site probably null
R6130:Pcsk5 UTSW 19 17511556 missense probably damaging 0.99
R6153:Pcsk5 UTSW 19 17511492 missense probably damaging 0.98
R6163:Pcsk5 UTSW 19 17473041 missense probably damaging 1.00
R6164:Pcsk5 UTSW 19 17836953 critical splice donor site probably null
R6228:Pcsk5 UTSW 19 17581267 missense possibly damaging 0.91
R6426:Pcsk5 UTSW 19 17617729 missense probably damaging 1.00
R6601:Pcsk5 UTSW 19 17511380 missense probably benign 0.00
R6648:Pcsk5 UTSW 19 17575821 missense probably damaging 0.99
R6789:Pcsk5 UTSW 19 17456786 missense possibly damaging 0.93
R6807:Pcsk5 UTSW 19 17572622 splice site probably null
R6837:Pcsk5 UTSW 19 17439084 missense probably benign 0.01
R6998:Pcsk5 UTSW 19 17473112 missense probably benign 0.20
R7051:Pcsk5 UTSW 19 17433731 missense probably benign 0.00
R7164:Pcsk5 UTSW 19 17451985 missense probably damaging 1.00
R7173:Pcsk5 UTSW 19 17477877 missense possibly damaging 0.85
R7348:Pcsk5 UTSW 19 17456818 nonsense probably null
R7360:Pcsk5 UTSW 19 17515213 missense probably benign 0.00
R7407:Pcsk5 UTSW 19 17675516 missense probably damaging 1.00
R7447:Pcsk5 UTSW 19 17510236 missense probably benign 0.31
R7521:Pcsk5 UTSW 19 17454832 missense probably benign 0.29
R7525:Pcsk5 UTSW 19 17642590 missense probably damaging 1.00
R7560:Pcsk5 UTSW 19 17836972 missense probably benign 0.01
R7566:Pcsk5 UTSW 19 17572457 missense probably benign
R7631:Pcsk5 UTSW 19 17564780 missense probably damaging 1.00
R7654:Pcsk5 UTSW 19 17456804 missense possibly damaging 0.46
R7677:Pcsk5 UTSW 19 17581229 missense possibly damaging 0.59
R7711:Pcsk5 UTSW 19 17439080 missense possibly damaging 0.82
R7903:Pcsk5 UTSW 19 17572483 missense probably damaging 0.98
R8032:Pcsk5 UTSW 19 17714787 missense probably damaging 0.98
R8064:Pcsk5 UTSW 19 17714861 missense probably damaging 1.00
R8115:Pcsk5 UTSW 19 17510166 critical splice donor site probably null
R8193:Pcsk5 UTSW 19 17586051 missense possibly damaging 0.64
X0023:Pcsk5 UTSW 19 17474872 missense possibly damaging 0.66
X0063:Pcsk5 UTSW 19 17447604 missense probably damaging 1.00
Z1088:Pcsk5 UTSW 19 17463374 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCTAAGCTACACAGGAAGAGTCAGTCA -3'
(R):5'- TGGACTCAGTATCTACCTGCCATGTT -3'

Sequencing Primer
(F):5'- GCACAAGATGCTGAGTATATCCTG -3'
(R):5'- AGTATCTACCTGCCATGTTTTCCC -3'
Posted On2014-03-14