Incidental Mutation 'R1543:Acadm'
Institutional Source Beutler Lab
Gene Symbol Acadm
Ensembl Gene ENSMUSG00000062908
Gene Nameacyl-Coenzyme A dehydrogenase, medium chain
MMRRC Submission 039582-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1543 (G1)
Quality Score225
Status Validated
Chromosomal Location153922357-153944632 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 153929572 bp
Amino Acid Change Tyrosine to Histidine at position 302 (Y302H)
Ref Sequence ENSEMBL: ENSMUSP00000072483 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000072697]
Predicted Effect probably damaging
Transcript: ENSMUST00000072697
AA Change: Y302H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000072483
Gene: ENSMUSG00000062908
AA Change: Y302H

Pfam:Acyl-CoA_dh_N 42 152 2e-27 PFAM
Pfam:Acyl-CoA_dh_M 157 255 2.3e-26 PFAM
Pfam:Acyl-CoA_dh_1 267 416 1.7e-48 PFAM
Pfam:Acyl-CoA_dh_2 283 405 2.1e-19 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000196688
Predicted Effect noncoding transcript
Transcript: ENSMUST00000199342
Predicted Effect noncoding transcript
Transcript: ENSMUST00000200250
Meta Mutation Damage Score 0.8322 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.1%
  • 10x: 95.7%
  • 20x: 90.2%
Validation Efficiency 95% (77/81)
MGI Phenotype FUNCTION: This gene encodes a homotetrameric mitochondrial flavoprotein and is a member of the acyl-CoA dehydrogenase family. Members of this family catalyze the first step of fatty acid beta-oxidation, forming a C2-C3 trans-double bond in a FAD-dependent reaction. As beta-oxidation cycles through its four steps, each member of the acyl-CoA dehydrogenase family works at an optimum fatty acid chain-length. This enzyme has its optimum length between C6- and C12-acylCoA. In mice, deficiency of this gene can cause neonatal mortality as well as fasting and cold intolerance. This gene has multiple, intronless pseudogenes. [provided by RefSeq, Nov 2012]
PHENOTYPE: Mice homozygous for a knock-out allele display a high degree of postnatal lethality, develop an organic aciduria, fatty liver and an unexpected diffuse cardiomyopathy with multifocal myocyte degeneration and necrosis, and show severe cold intolerance with prior fasting. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 77 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1810009J06Rik G A 6: 40,968,204 V206I probably damaging Het
2610507B11Rik A G 11: 78,275,174 T1422A probably benign Het
4933425L06Rik A T 13: 105,112,369 R364* probably null Het
Abca8b A C 11: 109,974,674 M319R probably damaging Het
Abcc6 T C 7: 46,016,504 R231G probably benign Het
Acox3 C A 5: 35,603,008 R423S probably damaging Het
Adam7 T A 14: 68,521,922 probably benign Het
Adgrb3 A C 1: 25,488,088 M589R probably benign Het
Adgrl2 A C 3: 148,859,273 F224V probably damaging Het
Adm2 G C 15: 89,324,079 G74A probably damaging Het
Aen T A 7: 78,902,622 V15E probably damaging Het
Ankzf1 T A 1: 75,192,516 V22D possibly damaging Het
Arap2 T A 5: 62,606,155 K1549* probably null Het
Arhgef11 G A 3: 87,713,017 R430H probably benign Het
Asb17 T G 3: 153,844,511 L60W probably damaging Het
BC035044 T C 6: 128,890,985 probably benign Het
Cacna2d1 A T 5: 16,266,718 M254L possibly damaging Het
Celf6 T C 9: 59,603,877 probably benign Het
Coro2b C T 9: 62,425,841 V120I probably benign Het
Cyp20a1 C A 1: 60,376,194 probably benign Het
Cyp2c67 C A 19: 39,643,264 probably benign Het
Dclk3 A G 9: 111,468,054 H222R probably benign Het
Deaf1 A G 7: 141,324,147 S109P possibly damaging Het
Dlg5 T A 14: 24,144,448 D1675V probably damaging Het
Dsg2 T A 18: 20,594,211 V605E probably benign Het
Frem2 A T 3: 53,572,455 I1939N possibly damaging Het
Fsip2 A T 2: 82,981,587 Y2750F possibly damaging Het
Gpr39 T A 1: 125,872,424 I304N probably damaging Het
Hdac7 G A 15: 97,809,529 probably benign Het
Hipk1 T C 3: 103,778,164 H45R probably benign Het
Hyal2 T C 9: 107,570,187 L13P probably damaging Het
Kdm1b C T 13: 47,068,521 R479W probably damaging Het
Lilr4b A G 10: 51,481,421 T118A probably damaging Het
Lin7a C A 10: 107,412,069 F78L possibly damaging Het
Lpin3 A G 2: 160,895,390 D119G possibly damaging Het
Lrp2 G A 2: 69,500,730 R1661C probably damaging Het
Lrrc45 A G 11: 120,720,018 K527E probably benign Het
Map10 C T 8: 125,670,872 P335S probably benign Het
Mast3 A G 8: 70,792,311 S2P possibly damaging Het
Mbtps1 A G 8: 119,542,069 probably benign Het
Mms22l T A 4: 24,591,084 N1018K probably benign Het
Nckipsd C A 9: 108,812,372 A244D possibly damaging Het
Olfr1294 A G 2: 111,537,797 V164A probably benign Het
Olfr3 A T 2: 36,813,057 F12I probably damaging Het
Olfr358 C A 2: 37,005,127 L162F probably damaging Het
Olfr592 T A 7: 103,187,214 F204L probably benign Het
Olfr876 T A 9: 37,803,947 I12N possibly damaging Het
Pcx A T 19: 4,602,223 D112V probably damaging Het
Phf14 G A 6: 11,987,683 probably null Het
Pkd1l1 A G 11: 8,901,200 I744T probably damaging Het
Ppip5k2 A G 1: 97,740,882 L560P probably damaging Het
Psmd14 A T 2: 61,785,530 M248L probably benign Het
Ryr1 T G 7: 29,083,537 E1884A possibly damaging Het
Scn4b T A 9: 45,150,429 S204R probably damaging Het
Slc12a1 A T 2: 125,184,857 M471L possibly damaging Het
Slc17a5 A G 9: 78,560,800 V236A probably benign Het
Sobp T C 10: 43,021,724 T622A probably damaging Het
Spata31d1a G T 13: 59,702,242 R691S probably benign Het
Speg A G 1: 75,421,951 E2014G probably damaging Het
Steap4 A G 5: 7,975,902 probably benign Het
Tas2r144 G A 6: 42,215,603 M92I probably benign Het
Tbc1d5 T C 17: 50,935,532 Q179R probably benign Het
Tcf25 T C 8: 123,388,587 Y188H probably benign Het
Tmem2 G T 19: 21,812,573 A668S probably benign Het
Tmem200a G A 10: 26,078,620 probably benign Het
Trappc9 G A 15: 73,025,967 R377W probably damaging Het
Tssk5 T C 15: 76,372,209 T337A probably benign Het
Ttc23 T C 7: 67,678,995 V228A probably benign Het
Tulp1 A T 17: 28,362,671 probably benign Het
Uqcc3 A G 19: 8,880,753 F25L probably damaging Het
Vmn2r1 G A 3: 64,089,573 G217S probably damaging Het
Vmn2r120 C T 17: 57,522,374 E508K probably benign Het
Wdfy3 C A 5: 101,844,081 V3451L probably benign Het
Wdr19 G A 5: 65,224,690 V418I probably benign Het
Wdr60 T C 12: 116,231,784 probably benign Het
Xirp2 C T 2: 67,508,039 T208I probably benign Het
Xpnpep1 A G 19: 52,991,676 V639A probably benign Het
Other mutations in Acadm
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02452:Acadm APN 3 153941970 missense probably damaging 1.00
IGL02598:Acadm APN 3 153938544 splice site probably benign
IGL02642:Acadm APN 3 153939083 missense probably damaging 1.00
R0092:Acadm UTSW 3 153941875 splice site probably benign
R0270:Acadm UTSW 3 153936324 missense possibly damaging 0.89
R1868:Acadm UTSW 3 153930252 missense probably benign 0.03
R1955:Acadm UTSW 3 153929551 missense probably damaging 0.97
R2281:Acadm UTSW 3 153933043 missense possibly damaging 0.75
R3774:Acadm UTSW 3 153933097 missense probably benign
R4768:Acadm UTSW 3 153922942 missense probably benign 0.00
R4994:Acadm UTSW 3 153929584 missense probably damaging 1.00
R5194:Acadm UTSW 3 153933118 missense possibly damaging 0.63
R5523:Acadm UTSW 3 153938636 missense probably benign 0.13
R5927:Acadm UTSW 3 153939108 missense probably damaging 1.00
R6109:Acadm UTSW 3 153941943 missense probably damaging 1.00
R6223:Acadm UTSW 3 153938549 splice site probably null
R6896:Acadm UTSW 3 153936320 missense probably damaging 0.99
R7108:Acadm UTSW 3 153925800 nonsense probably null
R7182:Acadm UTSW 3 153941881 critical splice donor site probably null
R7334:Acadm UTSW 3 153939061 nonsense probably null
R7440:Acadm UTSW 3 153922989 missense probably damaging 1.00
R7882:Acadm UTSW 3 153938613 nonsense probably null
R8170:Acadm UTSW 3 153944398 missense possibly damaging 0.93
R8405:Acadm UTSW 3 153929528 splice site probably benign
Predicted Primers PCR Primer

Sequencing Primer
(F):5'- acatcaacaaaaccaaaccaaac -3'
Posted On2014-04-13