Incidental Mutation 'R1543:Wdfy3'
ID 171914
Institutional Source Beutler Lab
Gene Symbol Wdfy3
Ensembl Gene ENSMUSG00000043940
Gene Name WD repeat and FYVE domain containing 3
Synonyms 2610509D04Rik, Ggtb3, Bchs, D5Ertd66e, Bwf1, Alfy
MMRRC Submission 039582-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.942) question?
Stock # R1543 (G1)
Quality Score 177
Status Validated
Chromosome 5
Chromosomal Location 101980822-102217787 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to A at 101991947 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Valine to Leucine at position 3451 (V3451L)
Ref Sequence ENSEMBL: ENSMUSP00000148521 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000053177] [ENSMUST00000174598] [ENSMUST00000212024]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000053177
AA Change: V3447L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000052607
Gene: ENSMUSG00000043940
AA Change: V3447L

DomainStartEndE-ValueType
low complexity region 463 481 N/A INTRINSIC
low complexity region 1408 1417 N/A INTRINSIC
low complexity region 1629 1644 N/A INTRINSIC
Pfam:PH_BEACH 2517 2638 3.1e-17 PFAM
Beach 2677 2958 2.54e-217 SMART
WD40 3054 3088 1.28e1 SMART
WD40 3098 3137 7.73e-6 SMART
WD40 3140 3178 8.29e-1 SMART
WD40 3183 3227 3.09e-1 SMART
low complexity region 3253 3274 N/A INTRINSIC
low complexity region 3307 3318 N/A INTRINSIC
WD40 3381 3420 1.33e1 SMART
FYVE 3428 3497 3.18e-27 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000173528
Predicted Effect noncoding transcript
Transcript: ENSMUST00000173955
Predicted Effect noncoding transcript
Transcript: ENSMUST00000173965
Predicted Effect noncoding transcript
Transcript: ENSMUST00000174312
Predicted Effect noncoding transcript
Transcript: ENSMUST00000174528
Predicted Effect probably benign
Transcript: ENSMUST00000174598
AA Change: V3465L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000134244
Gene: ENSMUSG00000043940
AA Change: V3465L

DomainStartEndE-ValueType
low complexity region 463 481 N/A INTRINSIC
Pfam:DUF4704 1392 1597 6.6e-11 PFAM
low complexity region 1629 1644 N/A INTRINSIC
Pfam:PH_BEACH 2588 2656 1.8e-14 PFAM
Beach 2695 2976 2.54e-217 SMART
WD40 3072 3106 1.28e1 SMART
WD40 3116 3155 7.73e-6 SMART
WD40 3158 3196 8.29e-1 SMART
WD40 3201 3245 3.09e-1 SMART
low complexity region 3271 3292 N/A INTRINSIC
low complexity region 3325 3336 N/A INTRINSIC
WD40 3399 3438 1.33e1 SMART
FYVE 3446 3515 3.18e-27 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000174864
Predicted Effect probably benign
Transcript: ENSMUST00000212024
AA Change: V3451L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Meta Mutation Damage Score 0.0824 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.1%
  • 10x: 95.7%
  • 20x: 90.2%
Validation Efficiency 95% (77/81)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a phosphatidylinositol 3-phosphate-binding protein that functions as a master conductor for aggregate clearance by autophagy. This protein shuttles from the nuclear membrane to colocalize with aggregated proteins, where it complexes with other autophagic components to achieve macroautophagy-mediated clearance of these aggregated proteins. However, it is not necessary for starvation-induced macroautophagy. [provided by RefSeq, May 2010]
PHENOTYPE: Mice homozygous for hypomorphic mutations of this gene exhibit perinatal lethality, altered neural progenitor divisions and neuronal migration, a regionally enlarged cerebral cortex, and focal cortical dysplasias. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 77 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1810009J06Rik G A 6: 40,945,138 (GRCm39) V206I probably damaging Het
Abca8b A C 11: 109,865,500 (GRCm39) M319R probably damaging Het
Abcc6 T C 7: 45,665,928 (GRCm39) R231G probably benign Het
Acadm A G 3: 153,635,209 (GRCm39) Y302H probably damaging Het
Acox3 C A 5: 35,760,352 (GRCm39) R423S probably damaging Het
Adam7 T A 14: 68,759,371 (GRCm39) probably benign Het
Adgrb3 A C 1: 25,527,169 (GRCm39) M589R probably benign Het
Adgrl2 A C 3: 148,564,909 (GRCm39) F224V probably damaging Het
Adm2 G C 15: 89,208,282 (GRCm39) G74A probably damaging Het
Aen T A 7: 78,552,370 (GRCm39) V15E probably damaging Het
Ankzf1 T A 1: 75,169,160 (GRCm39) V22D possibly damaging Het
Arap2 T A 5: 62,763,498 (GRCm39) K1549* probably null Het
Arhgef11 G A 3: 87,620,324 (GRCm39) R430H probably benign Het
Asb17 T G 3: 153,550,148 (GRCm39) L60W probably damaging Het
BC035044 T C 6: 128,867,948 (GRCm39) probably benign Het
Bltp2 A G 11: 78,166,000 (GRCm39) T1422A probably benign Het
Cacna2d1 A T 5: 16,471,716 (GRCm39) M254L possibly damaging Het
Celf6 T C 9: 59,511,160 (GRCm39) probably benign Het
Cemip2 G T 19: 21,789,937 (GRCm39) A668S probably benign Het
Coro2b C T 9: 62,333,123 (GRCm39) V120I probably benign Het
Cyp20a1 C A 1: 60,415,353 (GRCm39) probably benign Het
Cyp2c67 C A 19: 39,631,708 (GRCm39) probably benign Het
Dclk3 A G 9: 111,297,122 (GRCm39) H222R probably benign Het
Deaf1 A G 7: 140,904,060 (GRCm39) S109P possibly damaging Het
Dlg5 T A 14: 24,194,516 (GRCm39) D1675V probably damaging Het
Dsg2 T A 18: 20,727,268 (GRCm39) V605E probably benign Het
Dync2i1 T C 12: 116,195,404 (GRCm39) probably benign Het
Frem2 A T 3: 53,479,876 (GRCm39) I1939N possibly damaging Het
Fsip2 A T 2: 82,811,931 (GRCm39) Y2750F possibly damaging Het
Gpr39 T A 1: 125,800,161 (GRCm39) I304N probably damaging Het
Hdac7 G A 15: 97,707,410 (GRCm39) probably benign Het
Hipk1 T C 3: 103,685,480 (GRCm39) H45R probably benign Het
Hyal2 T C 9: 107,447,386 (GRCm39) L13P probably damaging Het
Kdm1b C T 13: 47,221,997 (GRCm39) R479W probably damaging Het
Lilrb4b A G 10: 51,357,517 (GRCm39) T118A probably damaging Het
Lin7a C A 10: 107,247,930 (GRCm39) F78L possibly damaging Het
Lpin3 A G 2: 160,737,310 (GRCm39) D119G possibly damaging Het
Lrp2 G A 2: 69,331,074 (GRCm39) R1661C probably damaging Het
Lrrc45 A G 11: 120,610,844 (GRCm39) K527E probably benign Het
Map10 C T 8: 126,397,611 (GRCm39) P335S probably benign Het
Mast3 A G 8: 71,244,955 (GRCm39) S2P possibly damaging Het
Mbtps1 A G 8: 120,268,808 (GRCm39) probably benign Het
Mms22l T A 4: 24,591,084 (GRCm39) N1018K probably benign Het
Nckipsd C A 9: 108,689,571 (GRCm39) A244D possibly damaging Het
Nt5el A T 13: 105,248,877 (GRCm39) R364* probably null Het
Or12k5 C A 2: 36,895,139 (GRCm39) L162F probably damaging Het
Or1j1 A T 2: 36,703,069 (GRCm39) F12I probably damaging Het
Or4k44 A G 2: 111,368,142 (GRCm39) V164A probably benign Het
Or52j3 T A 7: 102,836,421 (GRCm39) F204L probably benign Het
Or8b12c T A 9: 37,715,243 (GRCm39) I12N possibly damaging Het
Pcx A T 19: 4,652,251 (GRCm39) D112V probably damaging Het
Phf14 G A 6: 11,987,682 (GRCm39) probably null Het
Pkd1l1 A G 11: 8,851,200 (GRCm39) I744T probably damaging Het
Ppip5k2 A G 1: 97,668,607 (GRCm39) L560P probably damaging Het
Psmd14 A T 2: 61,615,874 (GRCm39) M248L probably benign Het
Ryr1 T G 7: 28,782,962 (GRCm39) E1884A possibly damaging Het
Scn4b T A 9: 45,061,727 (GRCm39) S204R probably damaging Het
Slc12a1 A T 2: 125,026,777 (GRCm39) M471L possibly damaging Het
Slc17a5 A G 9: 78,468,082 (GRCm39) V236A probably benign Het
Sobp T C 10: 42,897,720 (GRCm39) T622A probably damaging Het
Spata31d1a G T 13: 59,850,056 (GRCm39) R691S probably benign Het
Speg A G 1: 75,398,595 (GRCm39) E2014G probably damaging Het
Steap4 A G 5: 8,025,902 (GRCm39) probably benign Het
Tas2r144 G A 6: 42,192,537 (GRCm39) M92I probably benign Het
Tbc1d5 T C 17: 51,242,560 (GRCm39) Q179R probably benign Het
Tcf25 T C 8: 124,115,326 (GRCm39) Y188H probably benign Het
Tmem200a G A 10: 25,954,518 (GRCm39) probably benign Het
Trappc9 G A 15: 72,897,816 (GRCm39) R377W probably damaging Het
Tssk5 T C 15: 76,256,409 (GRCm39) T337A probably benign Het
Ttc23 T C 7: 67,328,743 (GRCm39) V228A probably benign Het
Tulp1 A T 17: 28,581,645 (GRCm39) probably benign Het
Uqcc3 A G 19: 8,858,117 (GRCm39) F25L probably damaging Het
Vmn2r1 G A 3: 63,996,994 (GRCm39) G217S probably damaging Het
Vmn2r120 C T 17: 57,829,374 (GRCm39) E508K probably benign Het
Wdr19 G A 5: 65,382,033 (GRCm39) V418I probably benign Het
Xirp2 C T 2: 67,338,383 (GRCm39) T208I probably benign Het
Xpnpep1 A G 19: 52,980,107 (GRCm39) V639A probably benign Het
Other mutations in Wdfy3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00332:Wdfy3 APN 5 102,063,204 (GRCm39) critical splice donor site probably null
IGL00567:Wdfy3 APN 5 102,059,896 (GRCm39) splice site probably benign
IGL01288:Wdfy3 APN 5 102,049,857 (GRCm39) splice site probably null
IGL01323:Wdfy3 APN 5 102,042,930 (GRCm39) missense probably damaging 1.00
IGL01352:Wdfy3 APN 5 102,091,986 (GRCm39) missense probably damaging 1.00
IGL01553:Wdfy3 APN 5 102,047,897 (GRCm39) missense probably benign
IGL01560:Wdfy3 APN 5 102,105,352 (GRCm39) nonsense probably null
IGL01566:Wdfy3 APN 5 102,044,454 (GRCm39) splice site probably benign
IGL01616:Wdfy3 APN 5 102,061,126 (GRCm39) missense probably damaging 0.97
IGL01630:Wdfy3 APN 5 102,055,354 (GRCm39) missense probably benign
IGL01791:Wdfy3 APN 5 102,085,278 (GRCm39) missense probably damaging 1.00
IGL01820:Wdfy3 APN 5 102,071,947 (GRCm39) missense probably benign 0.11
IGL01953:Wdfy3 APN 5 102,042,894 (GRCm39) nonsense probably null
IGL02121:Wdfy3 APN 5 102,046,376 (GRCm39) missense possibly damaging 0.85
IGL02167:Wdfy3 APN 5 102,109,023 (GRCm39) missense probably damaging 0.98
IGL02321:Wdfy3 APN 5 102,070,475 (GRCm39) missense probably damaging 0.99
IGL02327:Wdfy3 APN 5 102,036,058 (GRCm39) missense probably damaging 1.00
IGL02651:Wdfy3 APN 5 102,044,341 (GRCm39) missense probably benign 0.37
IGL02801:Wdfy3 APN 5 102,055,453 (GRCm39) missense probably damaging 1.00
IGL02839:Wdfy3 APN 5 102,116,786 (GRCm39) missense probably damaging 1.00
IGL02870:Wdfy3 APN 5 102,003,337 (GRCm39) missense probably damaging 1.00
IGL02997:Wdfy3 APN 5 102,042,778 (GRCm39) missense probably null 1.00
IGL03064:Wdfy3 APN 5 102,083,863 (GRCm39) missense probably damaging 0.99
IGL03090:Wdfy3 APN 5 102,014,142 (GRCm39) missense probably damaging 1.00
IGL03211:Wdfy3 APN 5 101,992,778 (GRCm39) splice site probably benign
IGL03237:Wdfy3 APN 5 101,992,465 (GRCm39) missense probably damaging 1.00
IGL03264:Wdfy3 APN 5 102,048,016 (GRCm39) missense probably damaging 1.00
Esurient UTSW 5 102,091,969 (GRCm39) missense probably damaging 1.00
IGL02988:Wdfy3 UTSW 5 102,077,847 (GRCm39) missense probably damaging 0.99
PIT4382001:Wdfy3 UTSW 5 102,030,827 (GRCm39) frame shift probably null
R0010:Wdfy3 UTSW 5 101,996,215 (GRCm39) missense probably damaging 1.00
R0010:Wdfy3 UTSW 5 101,996,215 (GRCm39) missense probably damaging 1.00
R0025:Wdfy3 UTSW 5 101,992,912 (GRCm39) missense probably damaging 0.98
R0031:Wdfy3 UTSW 5 102,037,161 (GRCm39) missense probably damaging 0.97
R0047:Wdfy3 UTSW 5 102,091,899 (GRCm39) missense probably damaging 1.00
R0047:Wdfy3 UTSW 5 102,091,899 (GRCm39) missense probably damaging 1.00
R0053:Wdfy3 UTSW 5 101,992,480 (GRCm39) missense probably damaging 0.97
R0078:Wdfy3 UTSW 5 102,035,971 (GRCm39) missense possibly damaging 0.57
R0147:Wdfy3 UTSW 5 102,065,277 (GRCm39) missense probably benign 0.05
R0148:Wdfy3 UTSW 5 102,065,277 (GRCm39) missense probably benign 0.05
R0279:Wdfy3 UTSW 5 102,015,958 (GRCm39) missense probably damaging 1.00
R0380:Wdfy3 UTSW 5 102,096,832 (GRCm39) missense probably damaging 0.99
R0472:Wdfy3 UTSW 5 102,105,309 (GRCm39) missense probably benign 0.13
R0513:Wdfy3 UTSW 5 102,038,655 (GRCm39) missense probably damaging 0.96
R0594:Wdfy3 UTSW 5 102,054,051 (GRCm39) missense possibly damaging 0.94
R0601:Wdfy3 UTSW 5 101,984,038 (GRCm39) missense probably benign
R0787:Wdfy3 UTSW 5 102,105,254 (GRCm39) missense probably damaging 1.00
R0825:Wdfy3 UTSW 5 102,017,917 (GRCm39) missense probably damaging 1.00
R1122:Wdfy3 UTSW 5 102,030,832 (GRCm39) missense possibly damaging 0.94
R1167:Wdfy3 UTSW 5 102,023,797 (GRCm39) missense probably benign
R1350:Wdfy3 UTSW 5 102,046,418 (GRCm39) missense probably damaging 1.00
R1422:Wdfy3 UTSW 5 102,032,080 (GRCm39) splice site probably benign
R1446:Wdfy3 UTSW 5 101,999,176 (GRCm39) missense possibly damaging 0.68
R1452:Wdfy3 UTSW 5 102,085,604 (GRCm39) missense possibly damaging 0.91
R1457:Wdfy3 UTSW 5 102,065,445 (GRCm39) missense possibly damaging 0.57
R1633:Wdfy3 UTSW 5 102,129,414 (GRCm39) missense probably damaging 1.00
R1643:Wdfy3 UTSW 5 102,023,781 (GRCm39) missense possibly damaging 0.62
R1656:Wdfy3 UTSW 5 102,089,313 (GRCm39) missense probably damaging 1.00
R1720:Wdfy3 UTSW 5 102,074,391 (GRCm39) frame shift probably null
R1743:Wdfy3 UTSW 5 101,991,931 (GRCm39) missense probably benign 0.12
R1745:Wdfy3 UTSW 5 102,096,795 (GRCm39) missense probably damaging 0.96
R1850:Wdfy3 UTSW 5 102,042,865 (GRCm39) missense probably damaging 1.00
R1852:Wdfy3 UTSW 5 102,063,242 (GRCm39) missense probably benign 0.00
R1854:Wdfy3 UTSW 5 102,036,052 (GRCm39) missense probably benign 0.05
R1880:Wdfy3 UTSW 5 102,065,301 (GRCm39) missense probably benign 0.05
R1930:Wdfy3 UTSW 5 102,089,358 (GRCm39) missense probably damaging 1.00
R1931:Wdfy3 UTSW 5 102,089,358 (GRCm39) missense probably damaging 1.00
R1956:Wdfy3 UTSW 5 102,067,275 (GRCm39) missense probably benign 0.30
R1965:Wdfy3 UTSW 5 102,099,178 (GRCm39) missense probably damaging 1.00
R1997:Wdfy3 UTSW 5 102,116,812 (GRCm39) missense probably damaging 1.00
R2015:Wdfy3 UTSW 5 102,008,352 (GRCm39) missense probably null 1.00
R2087:Wdfy3 UTSW 5 102,042,926 (GRCm39) missense probably damaging 1.00
R2156:Wdfy3 UTSW 5 102,046,291 (GRCm39) critical splice donor site probably null
R2192:Wdfy3 UTSW 5 102,055,408 (GRCm39) missense possibly damaging 0.55
R2313:Wdfy3 UTSW 5 102,037,150 (GRCm39) missense probably damaging 1.00
R2332:Wdfy3 UTSW 5 102,036,189 (GRCm39) splice site probably benign
R2406:Wdfy3 UTSW 5 102,036,125 (GRCm39) missense probably damaging 1.00
R2679:Wdfy3 UTSW 5 102,017,902 (GRCm39) missense probably damaging 1.00
R2857:Wdfy3 UTSW 5 102,023,796 (GRCm39) missense probably benign 0.04
R2937:Wdfy3 UTSW 5 102,091,988 (GRCm39) missense probably benign 0.07
R3765:Wdfy3 UTSW 5 102,009,266 (GRCm39) missense probably damaging 1.00
R3795:Wdfy3 UTSW 5 102,085,466 (GRCm39) missense probably damaging 1.00
R3937:Wdfy3 UTSW 5 102,092,105 (GRCm39) nonsense probably null
R3947:Wdfy3 UTSW 5 102,017,902 (GRCm39) missense probably damaging 1.00
R4024:Wdfy3 UTSW 5 102,071,961 (GRCm39) splice site probably benign
R4065:Wdfy3 UTSW 5 102,070,313 (GRCm39) missense probably benign 0.08
R4066:Wdfy3 UTSW 5 102,070,313 (GRCm39) missense probably benign 0.08
R4110:Wdfy3 UTSW 5 102,047,924 (GRCm39) critical splice donor site probably null
R4235:Wdfy3 UTSW 5 102,070,500 (GRCm39) critical splice acceptor site probably null
R4420:Wdfy3 UTSW 5 102,058,850 (GRCm39) missense probably damaging 0.97
R4620:Wdfy3 UTSW 5 102,054,011 (GRCm39) missense probably damaging 0.99
R4624:Wdfy3 UTSW 5 102,031,949 (GRCm39) missense possibly damaging 0.52
R4626:Wdfy3 UTSW 5 102,091,800 (GRCm39) missense probably damaging 1.00
R4727:Wdfy3 UTSW 5 102,077,894 (GRCm39) missense probably damaging 0.99
R4794:Wdfy3 UTSW 5 102,091,809 (GRCm39) missense probably damaging 1.00
R4869:Wdfy3 UTSW 5 102,042,787 (GRCm39) missense probably damaging 0.98
R4971:Wdfy3 UTSW 5 102,096,838 (GRCm39) nonsense probably null
R4973:Wdfy3 UTSW 5 102,090,985 (GRCm39) missense probably benign 0.00
R4976:Wdfy3 UTSW 5 102,090,985 (GRCm39) missense probably benign 0.00
R4984:Wdfy3 UTSW 5 102,090,985 (GRCm39) missense probably benign 0.00
R4986:Wdfy3 UTSW 5 102,090,985 (GRCm39) missense probably benign 0.00
R5068:Wdfy3 UTSW 5 102,042,803 (GRCm39) missense probably benign 0.15
R5105:Wdfy3 UTSW 5 102,003,415 (GRCm39) missense probably damaging 1.00
R5120:Wdfy3 UTSW 5 102,015,972 (GRCm39) missense possibly damaging 0.85
R5134:Wdfy3 UTSW 5 102,091,969 (GRCm39) missense probably damaging 1.00
R5139:Wdfy3 UTSW 5 101,997,133 (GRCm39) critical splice donor site probably null
R5235:Wdfy3 UTSW 5 101,994,972 (GRCm39) missense probably null 0.03
R5303:Wdfy3 UTSW 5 102,100,849 (GRCm39) missense probably damaging 1.00
R5368:Wdfy3 UTSW 5 102,020,724 (GRCm39) missense probably damaging 1.00
R5426:Wdfy3 UTSW 5 102,067,312 (GRCm39) missense probably damaging 0.97
R5442:Wdfy3 UTSW 5 102,044,425 (GRCm39) missense probably benign 0.04
R5487:Wdfy3 UTSW 5 101,984,140 (GRCm39) missense probably damaging 1.00
R5509:Wdfy3 UTSW 5 102,009,314 (GRCm39) missense possibly damaging 0.69
R5877:Wdfy3 UTSW 5 102,017,855 (GRCm39) missense probably damaging 1.00
R5988:Wdfy3 UTSW 5 102,032,004 (GRCm39) missense probably benign 0.00
R6017:Wdfy3 UTSW 5 101,999,225 (GRCm39) missense probably benign 0.01
R6019:Wdfy3 UTSW 5 101,997,289 (GRCm39) missense probably damaging 1.00
R6199:Wdfy3 UTSW 5 102,020,831 (GRCm39) missense possibly damaging 0.93
R6228:Wdfy3 UTSW 5 102,046,295 (GRCm39) missense possibly damaging 0.67
R6258:Wdfy3 UTSW 5 102,020,831 (GRCm39) missense possibly damaging 0.93
R6259:Wdfy3 UTSW 5 102,020,831 (GRCm39) missense possibly damaging 0.93
R6298:Wdfy3 UTSW 5 102,116,812 (GRCm39) missense probably damaging 1.00
R6479:Wdfy3 UTSW 5 102,061,045 (GRCm39) missense probably damaging 1.00
R6550:Wdfy3 UTSW 5 102,101,032 (GRCm39) missense probably benign 0.19
R6776:Wdfy3 UTSW 5 102,031,911 (GRCm39) missense possibly damaging 0.57
R6793:Wdfy3 UTSW 5 102,065,297 (GRCm39) nonsense probably null
R6809:Wdfy3 UTSW 5 102,071,813 (GRCm39) missense possibly damaging 0.63
R6836:Wdfy3 UTSW 5 102,100,865 (GRCm39) missense probably damaging 1.00
R6897:Wdfy3 UTSW 5 101,991,932 (GRCm39) missense probably benign 0.10
R7014:Wdfy3 UTSW 5 102,042,775 (GRCm39) critical splice donor site probably null
R7034:Wdfy3 UTSW 5 102,055,384 (GRCm39) missense probably damaging 1.00
R7035:Wdfy3 UTSW 5 102,003,415 (GRCm39) missense probably damaging 1.00
R7135:Wdfy3 UTSW 5 102,063,303 (GRCm39) missense probably damaging 1.00
R7182:Wdfy3 UTSW 5 102,091,758 (GRCm39) missense possibly damaging 0.51
R7217:Wdfy3 UTSW 5 102,049,785 (GRCm39) missense probably damaging 1.00
R7236:Wdfy3 UTSW 5 101,984,074 (GRCm39) missense probably damaging 0.99
R7264:Wdfy3 UTSW 5 102,003,389 (GRCm39) missense probably benign 0.02
R7418:Wdfy3 UTSW 5 102,105,366 (GRCm39) missense probably benign 0.08
R7533:Wdfy3 UTSW 5 102,030,354 (GRCm39) missense probably benign 0.27
R7543:Wdfy3 UTSW 5 102,083,925 (GRCm39) missense probably benign 0.00
R7625:Wdfy3 UTSW 5 102,003,252 (GRCm39) splice site probably null
R7788:Wdfy3 UTSW 5 101,996,223 (GRCm39) missense probably damaging 0.99
R7810:Wdfy3 UTSW 5 102,099,265 (GRCm39) nonsense probably null
R7810:Wdfy3 UTSW 5 102,042,940 (GRCm39) missense probably benign 0.01
R8204:Wdfy3 UTSW 5 102,000,451 (GRCm39) missense probably benign 0.00
R8268:Wdfy3 UTSW 5 102,089,476 (GRCm39) missense probably damaging 1.00
R8286:Wdfy3 UTSW 5 102,085,287 (GRCm39) missense probably benign
R8507:Wdfy3 UTSW 5 102,020,767 (GRCm39) missense probably benign 0.05
R8514:Wdfy3 UTSW 5 101,999,219 (GRCm39) missense possibly damaging 0.92
R8536:Wdfy3 UTSW 5 102,033,064 (GRCm39) missense probably benign
R8710:Wdfy3 UTSW 5 102,030,349 (GRCm39) missense probably damaging 1.00
R8735:Wdfy3 UTSW 5 102,077,951 (GRCm39) missense probably benign 0.00
R8749:Wdfy3 UTSW 5 102,030,446 (GRCm39) missense probably damaging 1.00
R8931:Wdfy3 UTSW 5 102,065,421 (GRCm39) missense probably benign 0.11
R8943:Wdfy3 UTSW 5 101,993,231 (GRCm39) intron probably benign
R8968:Wdfy3 UTSW 5 102,011,983 (GRCm39) missense probably benign 0.05
R8979:Wdfy3 UTSW 5 102,096,764 (GRCm39) missense probably damaging 1.00
R8998:Wdfy3 UTSW 5 101,993,058 (GRCm39) missense probably benign 0.05
R9045:Wdfy3 UTSW 5 101,995,040 (GRCm39) missense probably damaging 1.00
R9068:Wdfy3 UTSW 5 102,000,451 (GRCm39) missense probably benign 0.34
R9105:Wdfy3 UTSW 5 102,030,512 (GRCm39) missense probably benign 0.05
R9122:Wdfy3 UTSW 5 102,091,831 (GRCm39) missense probably damaging 1.00
R9209:Wdfy3 UTSW 5 102,078,830 (GRCm39) missense probably benign 0.01
R9249:Wdfy3 UTSW 5 101,996,359 (GRCm39) missense possibly damaging 0.82
R9348:Wdfy3 UTSW 5 102,089,358 (GRCm39) missense probably damaging 1.00
R9481:Wdfy3 UTSW 5 102,000,478 (GRCm39) missense probably benign 0.19
R9490:Wdfy3 UTSW 5 102,078,716 (GRCm39) missense probably benign 0.29
R9524:Wdfy3 UTSW 5 102,055,333 (GRCm39) missense probably benign 0.03
R9545:Wdfy3 UTSW 5 102,100,957 (GRCm39) missense
R9548:Wdfy3 UTSW 5 102,033,059 (GRCm39) missense probably damaging 0.99
R9636:Wdfy3 UTSW 5 102,047,899 (GRCm39) missense probably benign
R9750:Wdfy3 UTSW 5 102,077,960 (GRCm39) missense probably benign 0.00
R9766:Wdfy3 UTSW 5 102,042,866 (GRCm39) missense possibly damaging 0.90
R9771:Wdfy3 UTSW 5 102,000,195 (GRCm39) missense probably damaging 1.00
Z1177:Wdfy3 UTSW 5 102,048,107 (GRCm39) missense probably benign 0.39
Predicted Primers PCR Primer
(F):5'- AGAACAGTTCTGGCGGATGCAC -3'
(R):5'- CATGTTTTGCACAGGGATCACAGC -3'

Sequencing Primer
(F):5'- AGCCACTGCTGGTGACTG -3'
(R):5'- AGTGTTCAGCTGGTCTGTGA -3'
Posted On 2014-04-13